ISOLATED ENDOPHYTE, COMPOSITION, SEED AND METHODS TO IMPROVE SEED VITALITY, HEALTH AND/OR PLANT YIEL

专利摘要:
ISOLATED ENDOPHYTE, COMPOSITION, SEED AND METHODS TO IMPROVE SEED VITALITY, HEALTH AND/ORYIELD OF A PLANT.The present invention provides endophytic strains or cultures of thesame ones that have a symbiotic relationship with plants. The present inventionfurther provides a composition and a seed comprising the endophyte or culture thereof, as well as methods of improving the vitality of theseeds, resistance to biotic and abiotic stress, the health ofplants and production under stress and environmental conditions do notstressful, which includes inoculating a seed with the strainsnew endophytes and cultivate a plant of the same.
公开号:BR112015018618A2
申请号:R112015018618-1
申请日:2013-02-05
公开日:2021-07-20
发明作者:Vladimir Vujanovic；James J. Germida
申请人:University Of Saskatchewan；
IPC主号:

专利说明:

[001] [001] The present invention relates to fungal and bacterial endophytes of plants that improve the vitality of seeds and/or plant health, which provide general improvements in the agricultural characteristics of the plant, under normal and stressed conditions. The description also refers to these isolated endophytes. BACKGROUND
[002] [002] Fungi and bacteria are ubiquitous micro-organisms. Endophyte is the term first coined by de Bary [1866] to define microbes that asymptomatically colonize plant tissues [Stone et al., 2000]. The existence of endophytes has been known for over a century [Freeman 1904] and it appears that each individual host, out of 300,000 plant species, inhabits several to hundreds of endophytes [Tan and Zou, 2001]. Endophytes are microbial organisms primarily symbiotically or mutually associated with living tissue of host plants. Many are capable of conferring plant tolerance to abiotic stress, or can be used by the plant to defend against pathogenic fungi and bacteria [Singh et al. 2011]. Some of these microorganisms have been shown to be useful for the agricultural, forestry and horticultural sectors, as well as the production of medicinally important compounds.
[003] [003] Endophytes largely determine plant cell and whole plant genome regulation, including plant life cycles: (i) pre- and post-germination seed events (mycovitalism) [Vujanovic and Vujanovic 2007], (ii) ) plant nutrient uptake and growth-promoting mechanisms (mocoheterotrophism) [Smith and Read 2008], and (iii) plant tolerance to environmental stress.
[004] [004] While the spermosphere represents a rapidly changing and microbiologically dynamic zone of soil around a germinating seed [Nelson, 2004], the rhizosphere is a microbiologically active zone of bulk soil surrounding plant roots [ Smith and Read 2008]. The rhizosphere supports mycoheterotrophy or a symbiotic mycorrhizal-plant relationship. The spermosphere, on the other hand, promotes mycovitality or a relationship of endophyte fungi with plant seeds—improving seed vigor, energy, and germination uniformity that could reasonably be predicted. Endophytic fungi are distinct from mycorrhizae in that they not only can colonize roots, but also other plant organs, including seeds [Vujanovic et al. 2000; Hubbard et al. 2011]. They belong to the Ascomicota of multicellular phyla and Basidiomycota and form symbiotic colonization structures different from those produced by the unicellular or cenocytic phylum Glomeromicota, known as vesicular-arbuscular microrrhiza symbiosis [Abdellatif et al. 2009]. Endophytic bacteria were also found in practically all plants studied, where they colonize an ecological niche similar to that of fungi, such as healthy internal tissues. Although most endophytic bacteria appear to originate from the rhizosphere or phyllosphere; some can be transmitted through the seed [Ryan et al. 2008].
[005] [005] Seed germination is a vital phenophase for the survival and reproduction of plants under ideal or stressful environmental conditions. Microbial endophytic colonization in the seed state is especially critical because of the seed's role as a generative organ in the regeneration and dispersal of flowering plants [Baskin and Baskin 2004] and the role of mycobionts and symbiotically associated bacteria (bactobionts) as s potential drivers of seedling recruitment in natural habitats - undisturbed, disturbed and polluted - [Mühlmann and Peintner 2000; Adriaensen et al. 2006; White and Torres 2010]. Thus, the developing methods by which seedling emergence can be improved and protected under the constraints of disease pressure, heat or drought is invaluable. The use of symbiotic endophytes is a promising method by which seed germination can be increased [Vujanovic et al. 2000; Vujanovic and Vujanovic 2006; Vujanovic and Vujanovic 2007]. The hypothesis that the robustness of plant stress can be verified through a mycobiont-seed relationship known as mycovitality - a phenomenon that had been reserved for Orchidaceae [Vujanovic 2008] and via bactovitality that refers to a form of bactosymbiosis, using different endophytic strains with a variety of activities. SUMMARY
[006] [006] Endophytes can benefit host plants such as wheat, barley, legumes, oilseed rape, trees, shrubs or turf in a variety of ways, including bactovitality, mycovitality and mycoheterotrophy, and increased tolerance to environmental stress, such as shown here. Prenatal care in agriculture, as shown here with six endophytic strains, is more than just seed or germinal vitality, health or vigor. It also determines what to expect before and during the germination process, seedling establishment and, later on, crop productivity or yield.
[007] [007] Several symbiotic efficacy parameters (dormancy breaking, germination, growth and yield) were evaluated using endophytic Saskatchewan Microbial Collection and Database (SMCD) strain-crop interactions efficient under in vitro, phytotron, greenhouse and of field.
[008] [008] The ability of bacterial endophyte to confer seed vitality was also tested. For both fungal and bacterial endosymbionts, improved seed vitality can increase tolerance to biotic and abiotic stresses in plants that have progressed beyond the seedling stage to plant maturity via mycoheterotrophy.
[009] [009] Therefore, the present invention provides an isolated endophyte of Streptomyces sp strain. or culture thereof which is deposited with the International Depositary Authority of Canada (IDAC, National Microbiology Laboratory. Public Health Agency of Canada. 1015 Arlington Street, Winnipeg, Manitoba, Canada, R3E 3R2) accession number 081111-06 or which comprises the sequence of 16S rDNA as shown in SEQ ID NO: 6; an isolated endophyte of Paraconyothirium sp. or culture thereof which is deposited under IDAC accession number 081111-03 or which comprises the sequence ITS rDNA as shown in SEQ ID NO:5; an isolated endophyte of Pseudeurotium sp. or culture thereof which is deposited under IDAC accession number 081111-02 or which comprises the sequence ITS rDNA as shown in SEQ ID NO: 4; an isolated endophyte from Penicillium sp. or culture thereof which is deposited under IDAC accession number 081111-01 or which comprises the sequence ITS rDNA as shown in SEQ ID NO:3; an isolated culture of Cladosporium sp. which is deposited under accession number IDAC 200312-06 or which comprises the sequence ITS rDNA as shown in SEQ ID NO: 1 and/or an isolated endophyte from Cladosporium sp. or culture thereof which is deposited under IDAC accession number 200312-05 or which comprises the sequence ITS rDNA as shown in SEQ ID NO:2.
[0010] [0010] Also provided herein is a composition comprising an isolated endophyte or culture disclosed herein, or a combination or mixture thereof and a carrier.
[0011] [0011] Further provided herein is a seed comprising an endophyte or culture described herein. In one embodiment, the seed is coated with the endophyte. In another modality, the seed is planted in culture or close to the endophyte in such a way that the endophyte is able to colonize the seed.
[0012] [0012] The present invention also provides methods for improving seed vitality and improving plant health and productivity under normal and stressful conditions. Therefore, a method of improving seed vitality, plant health and/or plant yield is provided which comprises an inoculating seed with an endophyte or crop disclosed herein, or a combination or mixture thereof, or with a composition disclosed herein; and cultivate the seed into a first generation plant.
[0013] [0013] In one embodiment, the method comprises inoculating seeds with an isolated endophyte or culturing the same of the strain Streptomyces sp. which is deposited under IDAC 081111-06 or which comprises the 16S rDNA sequence as shown in SEQ ID NO: 6. In one embodiment, the method increases seed germination, decreases time to reach germination energy, reduces the time required for hydrothermal germination increases seed germination vigor, increases seedling fresh weight, increases Rhizobium nodulation activity and frequency, and/or increases seedling yield. In another modality, the method comprises reducing the effects of stress, such as drought, heat and/or biotic stress, such as Fusarium infection.
[0014] [0014] In another modality, the method comprises the inoculation of seeds with an isolated endophyte or culture thereof of the strain Paraconyothirium sp. which is deposited as IDAC 081111-03 or which comprises the sequence ITS rDNA as shown in SEQ ID NO: 5. In one embodiment, the method increases seed germination, decreases time to reach germination energy, reduces the time required for hydrothermal germination increases seed germination vigor, increases the fresh weight of seedlings and/or increases seedling yield. In another modality, the method comprises reducing the effects of stress, such as drought, heat and/or biotic stress, such as Fusarium infection.
[0015] [0015] In yet another modality, the method comprises the inoculation of seeds with an isolated endophyte or culture thereof of Pseudeurotium sp. which is deposited under IDAC 081111-02 or which comprises the sequence ITS rDNA as shown in SEQ ID NO: 4. In one embodiment, the method decreases the time to reach germination energy, reduces the time required for hydro- germination. thermal, increases seed germination vigor, and/or increases seedling fresh weight. In another modality, the buy method
[0016] [0016] In another modality, the method comprises the inoculation of seeds with an isolated endophyte or culture thereof of Penicillium sp. which is deposited under IDAC 081111-01 or which comprises the ITS rDNA sequence as shown in SEQ ID NO: 3. In one embodiment, the method increases seed germination, decreases time to reach germination energy, reduces the time required for hydrothermal germination increases seed germination vigor, and/or increases seedling yield. In another modality, the method comprises improved stratification, dormancy breaking and increased stress resistance through hormonal ent-kaurenoic modulation (KAO), repression of shoot growth genes (RSG), abscisic acid (ABA), gibberellic acid GA, 14-3-3 or nitric oxide (NO) and/or superoxide dismutase (SOD) stress resistance, manganese stress SOD (MnSOD), proline (Pro) or MYB gene expressions, reducing effects from stress such as drought, heat and/or biotic stress such as Fusarium infection.
[0017] [0017] In yet another modality, the method comprises the inoculation of seeds with an isolated endophyte or culture thereof of Cladosporium sp. which is deposited under IDAC 200312-06 or which comprises the ITS rDNA sequence as shown in SEQ ID NO: 1. In one embodiment, the method shortens the time to reach germination energy, reduces the time required for germination hydrothermal, increases seed germination vigor, and/or increases seedling fresh weight. In one embodiment, the method comprises reducing the effects of stress such as drought and/or heat.
[0018] [0018] In yet another additional modality, the method comprises the inoculation of seeds with an isolated endophyte or culture thereof of Cladosporium sp. which is deposited under IDAC 200312-05 or which comprises the sequence ITS rDNA as shown in SEQ ID NO: 2. In one embodiment, the method comprises reducing the effects of stress such as drought and/or heat stress.
[0019] [0019] In one embodiment, the seed is coated with the endophyte, cultivated with the endophyte, or planted close to the endophyte. In a particular modality, the seed planted close to the endophyte is about 4 cm away from the endophyte.
[0020] [0020] The plant can be any plant. In one modality, the plant is a cereal (wheat or barley), legume (pea, lentil or chickpea), flax, canola, coniferous tree (fir or pine), broadleaf tree (willow or poplar), shrub ( caragana or winterfat) or grass (twig or wildrye).
[0021] [0021] In another aspect, there is provided a method of improving plant health and/or plant yield comprising treating plant propagation material or a plant with an endophyte or crop disclosed herein, or a mixture or combination thereof or a composition disclosed herein; and cultivating the plant propagation material into a first-generation plant or allowing the plant to grow.
[0022] [0022] In one modality, the plant propagation material is any generative/sexual plant (seed, generative shoot or flower) and vegetative/asexual part (stem, cut, root, bulb, rhizome, tuber, vegetative shoot, or leaf) which has the ability to be cultivated into a new plant.
[0023] [0023] In one embodiment, the isolated endophyte or culture thereof is an isolated endophyte of Streptomyces sp. or culture thereof which is deposited with the International Depositary Authority of Canada (IDAC, National Microbiology Laboratory. Public Health Agency of Canada. 1015 Arlington Street, Winnipeg, Manitoba, Canada, R3E 3R2) accession number 081111-06 or which comprises to be-
[0024] [0024] In one modality, the methods enhance landscape development and repair. Therefore, in one embodiment, a method of reducing soil contamination is provided which comprises treating plant propagation material or a plant with an endophyte or crop disclosed herein, or a mixture or combination thereof or a composition herein. revealed; and cultivating the plant propagation material into a first-generation plant or allowing the plant to grow. In one embodiment, the soil contaminant is hydrocarbon, petroleum or other chemical substances, salts or metals such as lead, cadmium or radioisotopes.
[0025] [0025] In another modality, the methods reduce the effects of stress, such as heat, drought and/or biotic stress.
[0026] [0026] The plant can be any plant. In one modality, the plant is a cereal (wheat and barley), legume (pea, lentil or chickpea), flax, canola, coniferous tree (fir or pine), broadleaf tree (willow or poplar), shrub ( caragana or winterfat) or grass (fescue or wild rye).
[0027] [0027] Other features and advantages of the present invention will be apparent from the following detailed description. It should be understood, however, that the detailed description and specific examples, whilst indicating embodiments of the invention are presented by way of illustration only, as various changes and modifications within the spirit and scope of the description will will become apparent to those skilled in the art from this detailed description and related drawings and drawing captions. BRIEF DESCRIPTION OF THE DRAWINGS
[0028] [0028] The description will now be described in relation to the drawings in which:
[0029] [0029] Figure 1 shows the phenotypic appearance of endophytic fungal strains SMCD 2204, 2004F, 2206, 2208 and 2210 and bacterial strain SMCD 2215; after 10 days of growth in PDA at 21ºC.
[0030] [0030] Figure 2 shows the neighbor-joining phylogenetic tree inferred from Cladosporium spp. SMCD 2204 and SMCD 2204F based on their rDNA. Node numbers indicate bootstrap support values for 1000 repetitions; only values that were > 70% are shown. Bar indicates 0.01 nucleotide substitutions per site (nucleotide position).
[0031] [0031] Figure 3 shows the neighbor-joining phylogenetic tree inferred from Penicillium sp. SMCD 2206 based on its rDNA. Node numbers indicate bootstrap support values for 1000 replications; only values that were >70% are shown. Bar indicates 0.01 nucleotide substitutions per site (nucleotide position).
[0032] [0032] Figure 4 shows the neighbor-joining infe-
[0033] [0033] Figure 5 shows the neighbor-joining phylogenetic tree inferred from Coniothyrium strain SMCD 2210 based on its rDNA. Node numbers indicate bootstrap support values for 1000 replications; only values that were >70% are shown. Bar indicates 0.05 nucleotide substitutions per site (nucleotide position).
[0034] [0034] Figure 6 shows the inferred neighbor-joining phylogenetic tree of Streptomyces sp strain SMCD 2215 based on 16S rDNA. Node numbers indicate bootstrap support values for 1000 replications; only values that were > 60% are shown. Bar indicates 0.05 nucleotide substitutions per site (nucleotide position).
[0035] [0035] Figure 7 shows left compartments of dividing plates (plants with microbial partner): healthy phenotypic appearance of wheat when the root is grown in contact with microbial mats; and right compartments of dividing plates (plants without microbial partner): massive formation of wheat root hairs due to the plant-fungus association made in the left compartments of the dividing plates.
[0036] [0036] Figure 8 (A) and (C) shows SMCD2206 discontinuous colonization of wheat root (epidermis and cortex) tissue compared to (B) and (D), which shows uniform/continuous cell colonization of Fusarium graminearum Wheat root pathogen including vascular cylinder.
[0037] [0037] Figure 9 shows IREG Index - deviation level (irregular-
[0038] [0038] Figure 10 shows Idir Index - direction level changes when colonizing live plant host cell.
[0039] [0039] Figure 11 shows endophytic hyphae in germinal wheat roots (A-SMCD 2204; B-SMCD 2206; C-SMCD 2210; and D-SMCD-2215) visualized with lactofuchsin staining and fluorescence microscopy. Symbiotic/organ structures: (D) Bacterial endophyte SMCD 2215 formed mainly intercellular curly filaments, while endophytic fungi (pictures at right) produced: Intracellular tangles and arbuscles of SMCD 2204, intracellular vesicles of SMCD 2206, and intracellular nodes of SMCD 2110.
[0040] [0040] Figure 12 shows the appearance of wheat seedlings in symbiotic germination after 10 days on filter paper moistened at 21ºC.
[0041] [0041] Figure 13 shows leaf length of germinating wheat seedlings after 10 days on filter paper moistened at 21ºC.
[0042] [0042] Figure 14 shows an in vitro inoculation method (A). A 5 mm 2 plug in agar, cut from the margin of the parent colony, was placed next to the hyphae down into the center of a 60 mm Petri dish containing medium potato dextrose agar (PDA). Then, five surface sterilized seeds were placed at a distance equivalent to 48 h of hyphal growth from the agar plug and germinated in the dark. The impact of three surface seed sterilization methods on seed germination (B). Bars marked with one or two asterisks (*) are significantly, or highly significantly, different from the same endophyte cultured under control conditions (p ≤ 0.05 or p ≤ 0.01, respectively; ANOVA followed by post test -hoc LSD). Error bars represent the standard error of the mean (SE).
[0043] [0043] Figure 15 shows the growth rates of free-living endophytes SMCD 2204, 2206, 2208, 2210, and 2215 in vitro on potato dextrose agar (PDA) under heat stress (36°C), heat stress dry (8% polyethylene glycol (PEG) 8000) and control conditions for five days and simultaneously heat (36°C) and dry (8% PEG) for six days. Bars marked with one or two asterisks (*) are significantly, or highly significantly, different from the same endophyte cultured under control conditions (p ≤ 0.05 or p ≤ 0.01, respectively; ANOVA followed by post-hoc test LSD). Error bars represent the standard error of the mean (SE).
[0044] [0044] Figure 16 shows the percentage of germination and fresh mass of seedlings from initial experiments in which the seeds were surface sterilized in 5% sodium hypochlorite for 3 min. Percent germination of wheat seeds in vitro after three days on potato dextrose agar (PDA) under heat stress (36 o C), water stress (8% polyethylene glycol (PEG) 8000) and control conditions ( A, B and C) with the y axis normalized to the percentage of germination obtained under the same conditions by seeds sterilized on the surface with 5% sodium hypochlorite for 1 min. Fresh weight of seedlings in vitro in seven days on PDA under heat stress, water stress and control conditions (D, E and F). Bars marked with an (*) or two asterisks (**) are significantly, or highly significantly, different from control without endophyte (p ≤ 0.05 or p ≤ 0.01, respectively; ANOVA followed by post-hoc LSD test) . Error bars represent the standard error of the mean (SE).
[0045] [0045] Figure 17 shows the percentage germination over time of wheat seeds co-cultivated with the most effective endophytes to confer tolerance to abiotic stress (SMCD 2206, 2210 and 2215), compared to unstressed, non-colonized seeds (positive control) and uncolonized seeds, stressed (negative control). Germination energy (GE) is related to the time, in days (x-axis) when 50% of germination (y-axis) is achieved. The symbols "■", "x", "○", "∆", and "□" represent the positive control, treated SMCD 2206 seeds, treated SMCD 2210 seeds, treated SMCD 2215 seeds and negative control, respectively . Heat and dry treatments correspond to 36°C and 8% polyethylene glycol (PEG) 8000, respectively. Error bars represent the standard error of the mean (SE). Note: The seeds used in the EG determination were from the second round of experiments, and therefore sterilized in 5% sodium hypochlorite solution for one minute instead of three.
[0046] [0046] Figure 18 shows the relationship between the hydrothermal time (HTT) required to achieve 50% germination for heat and drought alone and 5% germination for combined heat and drought (x-axis) and the percentage of germination achieved after seven days (y axis). Germination after seven days and HTT were based on the results of the second round of experiments. The symbols "■", "◆" and "▲" represent seeds exposed to heat (36°C), dry (8% polyethylene glycol (PEG) 8000) or both heat and dry, respectively. The R-squared values associated with the trend lines are 0.96, 0.80 and 0.18 for seeds exposed to heat, drought or heat and water stress, respectively. Note: The seeds used to determine the percentage of germination at seven days and HTT were from the second round of experiments, and therefore treated with 5% sodium hypochlorite for one minute instead of three.
[0047] [0047] Figure 19 shows seeds treated or inoculated with SMCD strains demonstrates improvement in all germination parameters of seeds tested, including efficacy in seed germination vigor (SGV).
[0048] [0048] Figure 20 shows the relationship between the drought tolerance efficiency (DTE) values in wheat (A) and barley (B) cultivars without (E-) and with (E +) endophytes, based on the mean effect of symbiosis using all tested SMCD isolates, on production exposed to water stress in the greenhouse.
[0049] [0049] Figure 21 shows (A) endophytic inoculants (E +) (SMCD 2206, SMCD 2210, and SMCD 2215) that improve grain yield in wheat genotypes compared to treatment with control (E-) (yield g /3 pots). (B) Endophytic inoculants (SMCD 2206, SMCD 2210, and SMCD 2215) improve grain yield in two-row barley (B a ) and six-row barley (B b) in genotypes (kernel yield: 3plants/ vase).
[0050] [0050] Figure 22 shows (A) Six-row barley AC Metcalfe, from left to right: Seca (E-), Seca and SMCD 2206 (E +), Control (E-), Control and SMCD 2206 ( E+); (B) Unity wheat cultivar, from left to right: Seca (E-), Seca and SMCD 2215 (E +), Control (E-), Control and SMCD 2215 (E +); (C) Verona wheat cultivar, from left to right: Seca (E-), Seca and SMCD 2215 (E +), Control (E-), Control and SMCD 2215 (E +); and (D) Durum-TEAL wheat, from left to right: Dry (E-), Dry and SMCD 2210 (E +), Control (E-), Control and SMCD 2210 (E +).
[0051] [0051] Figure 23 shows trunk dry weight of (A) chickpeas, (B) lentils, and (C) peas in symbiosis with SMCD endophytes (E+) under phytotron conditions of heat stress. Bars marked with an (*) or two asterisks (**) are significantly, or highly significantly, different from stressed control without endophyte (p ≤ 0.05 or p ≤ 0.01, respectively; ANOVA followed by post-hoc test LSD).
[0052] [0052] Figure 24 shows dry weight of (A) chickpeas, (B) lentils, and (C) peas pods in symbiosis with SMCD endophytes (E+) under phytotron conditions of heat stress. Bars marked with an (*) or two asterisks (**) are significantly, or highly significantly, different from stressed control without endophyte (p ≤ 0.05 or p ≤ 0.01, respectively; ANOVA followed by post-hoc test LSD).
[0053] [0053] Figure 25 shows root dry weight of (A) chickpeas, (B) lentils, and (C) peas in symbiosis with SMCD endophytes (E+) under phytotron conditions of heat stress. Bars marked with an (*) or two asterisks (**) are significantly, or highly significantly, different from stressed control without endophyte (p ≤ 0.05 or p ≤ 0.01, respectively; ANOVA followed by post-hoc test LSD).
[0054] [0054] Figure 26 shows stem dry weight of (A) chickpeas, (B) peas and lentils (C) under water stress in a greenhouse. Bars marked with an (*) or two asterisks (**) are significantly, or highly significantly, different from the non-endophyte (E-), stressed control (p ≤ 0.05 or p ≤ 0.01, respectively; ANOVA, followed by post-hoc LSD test).
[0055] [0055] Figure 27 shows pod dry weights of (A) chickpeas, (B) peas, and (C) lentils, in association with an endophyte (E+) under water stress in the greenhouse. Bars marked with an (*) or two asterisks (**) are significantly different from the stressed control without endophyte (E-), (p ≤ 0.05 or p ≤ 0.01, respectively; ANOVA followed by the post-test hoc LSD).
[0056] [0056] Figure 28 shows the dry weight of roots of (A) chickpeas, (B) peas and lentils (C) under water stress in a greenhouse. Bars marked with an (*) or two asterisks (**) are significantly, or highly significant, different from stressed control without endophyte (E-) (p ≤ 0.05 or p ≤ 0.01, respectively; ANOVA, followed by LSD post-hoc test).
[0057] [0057] Figure 29 shows A. Vanguard chickpea flowering plants containing pods under water stress in a greenhouse - left plant is non-symbiotic (E-) and right plant is symbiotic with the SMCD 2215 strain ( E+); B and C, Vanguard chickpea plants containing pods under water stress in a greenhouse - (B) non-symbiotic and (C) symbiotic with SMCD 2215.
[0058] [0058] Figure 30 shows root nodulation of pea varieties under heat stress in a phytotron: Hendel (Above) and Golden (Below) inoculated (left) and uninoculated (right) with SMCD
[0059] [0059] Figure 31 shows SMCD2206 and SMCD 2215 considerably increase seed germination energy (≥50%) in Glamis (lentil) as a function of time under heat and dryness in vitro.
[0060] [0060] Figure 32 shows SMCD2206 and SMCD 2215 considerably increase seed germination energy (≥50%) in Handel (pea) as a function of time under heat and dryness in vitro.
[0061] [0061] Figure 33 shows endophytic inoculants (SMCD 2206 and 2210) SMCD improve flax yield under dry conditions in a greenhouse. Different letters above the bars indicate statistically significant differences between samples (p < 0.05, Kruskal-Wallis test).
[0062] [0062] Figure 34 shows endophytic inoculants (SMCD 2206, SMCD 2210, and SMCD 2215) improve Canola yield under dry conditions in a greenhouse. Different letters above the bars indicate statistically significant differences between samples (p < 0.05, Kruskal-Wallis test).
[0063] [0063] Figure 35 shows the survival of pre-inoculated wheat seeds in vitro - (plates in row above) and wheat seedlings pre-inoculated in greenhouse (pots in the bottom row) with endophytic SMCD 2206 - showing growth healthy plants, and with pathogenic Fusarium avenaceum and Fusarium graminearum - showing symptoms of plant disease and death.
[0064] [0064] Figure 36 shows Fusarium inoculants produced in wheat grains.
[0065] [0065] Figure 37 shows that post-emergence tipping was im-
[0066] [0066] Figure 38 shows wheat biomass (a-d aerial and e-f root) improved in the presence of endophyte SMCD 2206 compared to untreated plants. (a) control plant (E-), (b) inoculated plant (E +), (c) control flowering plants, (d) inoculated flowering plant, (e) control plant (E-, left) compared to plant inoculated with SMCD 2206 (E +, right), and (f) fluorescence microscopy of wheat root colonization with SMCD 2206 (E +).
[0067] [0067] Figure 39 shows an aerial biomass/plant (left) and subterranean biomass/plant (root) (right) in the control (E-) and plant inoculated with SMCD (E+) against F. graminearum and F. avenaceum . Vertical error bars at data points represent the standard error of the mean.
[0068] [0068] Figure 40 shows root length in control plant (CDC Teal) without endophyte SMCD compared to plant inoculated with SMCD strains. Bars at data points represent the standard error of the mean.
[0069] [0069] Figure 41 shows the dry weight of grains/plant (cultivar TEAL) using the dual pre-inoculation approach: a) endophyte SMCD + Fusarium avenaceum (F.av), and b) endophyte SMCD + Fusarium graminerum (F. gr). Vertical error bars at data points represent the standard error of the mean.
[0070] [0070] Figure 42 shows comparison of TEAL peak sizes in the presence of the pathogen (negative control) and without the presence of the pathogen (positive control). Figure from left - from left to right: i) plant + F.gr, ii) plant + F.av, and (iii) plant; figure from right -from left to right: i) plan; ii) plant + endophyte; iii) plant + endophyte + F. av; and iv) plant + endophyte + F.gr.
[0071] [0071] Figure 43 shows a specific symbiotic germination strain pattern describing mycovitality: Handel + 6% PEG -
[0072] [0072] Figure 44 shows relative (A) SOD and (B) MnSOD gene expressions in Handel exposed to PEG with and without endophytes.
[0073] [0073] Figure 45 shows the relative gene expression of proline in Handel exposed to PEG with and without endophytes.
[0074] [0074] Figure 46 shows the germination of wheat seeds in vitro after three days on potato dextrose agar (PDA). Cold stratification was imposed by keeping seeds in a 4 0 C cold room for 48 hours. For indirect and direct endophyte treatments, the seeds were germinated at about 4 cm apart and in direct contact, respectively. A) Germination percentage, compared to germination energy (50% germination). B) The germination efficiency of wheat seeds submitted to cold and biological stratification. Efficacy was calculated by subtracting the germination percentage from the control of treated seeds.
[0075] [0075] Figure 47 shows the differential expression patterns of gibberellin (TaGA3ox2 and 14-3-3) and ABA (TaNCED2 and TaA-BA8'OH1 ) genes in germinating wheat seed coleorrhyase for three days, under cold stratification and biological. Gene expression was calculated as 2 -  CT .
[0076] [0076] Figure 48 shows the relationship between expression levels (2 -  CT ) of gibberellin (TaGA3ox2 and 14-3-3) and ABA (TaNCED2 and TaABA8'OH1) genes in germinating wheat seed coleorrhyza pa- for three days, under cold and biological stratification.
[0077] [0077] Figure 49 shows the relative expression patterns of hormonal RSG genes and KAO regulators and resistance genes MYB 1 and MYB 2 in coleorrhya from germinating wheat seeds for three days, under cold and biological stratification. Gene expression was calculated as 2 - ∆ CT .
[0078] [0078] Figure 50 shows emerging radicle from germinating wheat seeds (A) of inverted fluorescence (B) and DAF-2DA fluorescence fluorescence imaging after reaction with NO in root cells (C) of germinative AC Avonlea in 5 minutes after treatment [Nakatsubo et al. 1998] with SMCD 2206 fungus exudate. No fluorescence reaction observed in control root cells. Bar =25m; Bar =50 m.
[0079] [0079] Figure 51 shows DAF-2T fluorescence intensity values at 5 min after treatment of wheat radicle from AC Avonlea germinants with SMCD 2206 fungus exudate, fungus exudate together with cPTIO NO scavenger, and sterile water. Radicle segments were incubated for 30 min in 2 ml detection buffer (10 mM Tris-HCl, pH 7.4, 10 mM KCl) containing 15 M FAD-2DA (Sigma-Aldrich) with or without 1 mM 2-(4-carboxyphenyl)-4,4,5,5-tetramethylimidazoline-1-oxy-3-oxide (cPTIO) as a NO scavenger. Mean fluorescence values are presented as a ratio of the fluorescence intensity at 5 minutes to the fluorescence intensity at time 0. Different letters indicate statistically significant differences between samples (p < 0.05, Kruskal test -Wallis).
[0080] [0080] The present inventors have isolated six new endophytic strains that improve seed vitality and plant health and under normal yield conditions and/or stressed conditions. These endophytes were deposited as follows: International Depository Authority of Canada - IDAC (original deposited strains - IDAC, National Microbiology Laboratory, Public Health Agency of Canada, 1015
[0081] [0081] IDAC 081111-06 = SMCD 2215;
[0082] [0082] IDAC 081111-03 = SMCD 2210;
[0083] [0083] IDAC 081111-02 = SMCD 2208;
[0084] [0084] IDAC 081111-01 = SMCD 2206;
[0085] [0085] IDAC 200312-06 = SMCD 2204; and
[0086] [0086] IDAC 200312-05 = SMCD 2204F.
[0087] [0087] Therefore, the present invention provides an isolated endophyte of Streptomyces sp. or culture thereof which is deposited under IDAC 081111-06 or which comprises the sequence of 16S rDNA as shown in SEQ ID NO: 6; an isolated endophyte of Paraconyothirium sp. or culture thereof which is deposited as IDAC 081111-03 or which comprises the sequence ITS rDNA as shown in SEQ ID NO:5; an isolated endophyte of Pseudeurotium sp. or culture thereof which is deposited under IDAC 081111-02 or which comprises the sequence ITS rDNA as shown in SEQ ID NO: 4; an endophyte isolated from Penicillium sp. or culture thereof which is deposited under IDAC 081111-01 or which comprises the sequence ITS rDNA as shown in SEQ ID NO:3; an isolated culture of Cladosporium sp. which is deposited under IDAC 200312-06 or which comprises the sequence ITS rDNA as shown in SEQ ID NO: 1; and/or an isolated endophyte from Cladosporium sp. or culture thereof which is deposited under IDAC 200312-05 or which comprises the sequence ITS rDNA as shown in SEQ ID NO: 2; or combinations or mixtures thereof.
[0088] [0088] The term "endophyte" as used herein refers to a bacterial or fungal organism that can live symbiotically in a plant and is also referred to herein as "endosymbiont". an endo-
[0089] [0089] Also provided herein is a composition comprising an isolated endophyte or culture disclosed herein, or a combination or mixture thereof and a carrier. Typical carriers include, but are not limited to, an inert (non-carbon-based) material used to support and deliver the active ingredient densely populated with the target, and optionally adjuvant compounds that: promote and sustain the function of the active ingredient to protect against UV radiation; ensure solidity with rain on target; retain moisture or protect against desiccation; and/or promote the dissemination and dispersion of the biopesticide using conventional agricultural equipment, such as those disclosed by Hynes and Boyetchko (2006, Soil Biology & Biochemistry 38: 845-84).
[0090] [0090] In another embodiment, the compositions comprise at least two, at least three, at least four, at least five or six of the endophyte strains or cultures described herein.
[0091] [0091] Further provided herein is a seed comprising an endophyte or culture disclosed herein, or a combination or mixture thereof.
[0092] [0092] In one embodiment, the seed is inoculated by means of soil-based inoculation. In another modality, the seed is coated with its endophyte or culture. In yet another modality, the seed is sprayed, injected, inoculated, grafted, coated or treated with its endophyte or culture. Methods
[0093] [0093] A method of increasing seed vitality, plant health and/or seed yield is further provided herein.
[0094] The phrase "inoculate a seed" as used herein refers to the application, infection, co-plantation or coating of the seed with the endophyte. Techniques for seed inoculation are known in the art, for example as described by Hynes and Boyetchko (2006, Soil Biology & Biochemistry 38: 845-84).
[0095] [0095] The term "improving seed vitality" as used herein refers to prenatal care of the plant by improving the ability of the seeds to germinate and produce a plant under normal and/or stressed conditions and includes, without limitation, any one or more of the following: dormancy break, provide seed stratification, increase seed germination, modulate gene expression, reduce time to reach germination energy, protect against biotic stresses, protect against species abiotic stresses, reduce time required for hydrothermal germination, increase seed germination vigor, increase seed germination efficiency, increase seed germination uniformity, improve drought/heat tolerance efficacy , increase seedling weight and increase seedling yield. Drought/Heat Tolerance Efficiency (DTE/A) is the opposite (antonymous) term to susceptibility.
[0096] [0096] Germination energy is defined as 50% of germination, in relation to the number of seeds tested. Seed germination vigor shows the difference between the total germination percentage of treated seeds and untreated germinating seeds. Hydrothermal time postulates that an individual seed begins to germinate when the sum of both temperatures and po-
[0097] [0097] The term "improving plant health and/or yield" as used herein refers to general improvements in the agricultural characteristics of plants (e.g., health and productivity) of the resulting plant under normal conditions and/or conditions of stress and includes, without limitation, any one or more of the following: modulate RSG, KAO, ABAs, GAs, 14-3-3 or NO gene expression to improve plant hormonal activities, modulate gene expression of MYBs, Pro, SOD, or MnSOD to improve stress resistance such as resistance to biotic and abiotic stresses, increase the weight of various tissues such as root, stem, leaves and pods, increase Rhizobium activity and nodulation frequency and improve characteristics of the first or subsequent generations of seed, including, without limitation, any one or more of the following: seed weight of the subsequent generation and energy of the subsequent generation of germination.
[0098] [0098] Horomonal genes KAO, RSG, ABAs, GAs, 14-3-3 and primer sets are as disclosed by Zhang et al. [2007]. Stress resistance of SOD, MnSOD, Pro and MYB genes and primer sets are shown in Table 6 and Table 9 (SEQ ID NO: 8-19).
[0099] [0099] The term "decrease" or "increase" as used herein refers to a decrease or increase in a characteristic of seeds treated with endophyte or resulting plant compared to untreated seeds or a resulting plant. For example, a decrease in a trait can be at least 5%, 10%, 15%, 25%, 50%, 75%, 100%, or 200% or less than the untreated control and a increase can be at least 5%, 10%, 15%, 25%, 50%, 75%, 100%, or 200% or greater than untreated control.
[00100] [00100] In one embodiment, the plant is grown under stressed abiotic or biotic conditions.
[00101] The term "abiotic stress" as used herein refers to a non-living stress, which typically affects seed vitality and plant health and includes, without limitation, heat stress and drought. In one modality, abiotic stress is heat stress. In another modality, abiotic stress is drought stress, osmotic stress or salt stress. The term "biotic stress" as used herein refers to a live stress that typically affects seed vitality and plant health, and includes, without limitation, microbial plant infections. In one modality, the biotic stress is a Fusarium infection.
[00102] [00102] In one embodiment, the method comprises seed inoculation with an isolated endophyte or culture thereof of the Streptomyces sp strain. which is deposited under IDAC 081111-06 or which comprises the 16S rDNA sequence as shown in SEQ ID NO: 6. In one embodiment, the method increases seed germination, to decrease the time to reach germination energy, to reduce the time required for hydrothermal germination, to increase seed germination vigor, to increase seedling fresh weight, to increase Rhizobium activity and nodulation frequency, and/or to increase seedling production. In one modality, the method comprises reducing the effects of stress, such as drought, heat and/or biotic stress.
[00103] [00103] In another modality, the method comprises the inoculation of seeds with an isolated endophyte or culture thereof of the Paraconyothirium sp. which is deposited as IDAC 081111-03 or which comprises the sequence ITS rDNA as shown in SEQ ID NO: 5. In one embodiment, the method increases seed germination, decreases time to reach germination energy, reduces the time required for hydrothermal germination increases seed germination vigor, increases the fresh weight of seedlings and/or increases seedling yield. In another modality, the method comprises reducing the effects of stress, such as drought, heat and/or biotic stress.
[00104] [00104] In yet another modality, the method comprises the inoculation of seeds with an isolated endophyte or culture thereof of Pseudeurotium sp. which is deposited under IDAC 081111-02 or which comprises the sequence ITS rDNA as shown in SEQ ID NO: 4. In one embodiment, the method decreases the time to reach germination energy, reduces the time required for hydro- germination. thermal, increases seed germination vigor, and/or increase in seedling fresh weight. In another modality, the method comprises reducing the effects of stress, such as drought and/or heat stress.
[00105] [00105] In another modality, the method comprises the inoculation of seeds with an isolated endophyte or culture thereof of Penicillium sp. which is deposited under IDAC 081111-01 or which comprises the ITS rDNA sequence as shown in SEQ ID NO: 3. In one embodiment, the method increases seed germination, decreases time to reach germination energy, reduces the time required for hydrothermal germination increases seed germination vigor, and/or increases seedling yield. In another modality, the method comprises reducing the effects of stress, such as drought, heat and/or biotic stress. In another modality, the method comprises increasing stratification, breaking dormancy and increasing resistance to stress through the modulation of hormonal genes KAO, RSG, ABAs, GAs, 14-3-3 or NO and/or expression of genes of resistance to stress SOD, MnSOD, Pro or MYB, reducing the effects of stress such as drought, heat and/or biotic stress.
[00106] [00106] In yet another modality, the method comprises the inoculation of seeds with an isolated endophyte or culture thereof of Cladosporium sp. which is deposited under IDAC 200312-06 or which comprises the ITS rDNA sequence as shown in SEQ ID NO: 1. In one embodiment, the method shortens the time to reach germination energy, reduces the time required for germination hydrothermal, increases seed germination vigor, and/or increases seedling fresh weight. In one embodiment, the method comprises reducing the effects of stress such as drought and/or heat.
[00107] [00107] In yet another additional modality, the method comprises the inoculation of seeds with an isolated endophyte or culture thereof of Cladosporium sp. which is deposited under IDAC 200312-05 or which comprises the sequence ITS rDNA as shown in SEQ ID NO: 2. In one embodiment, the method comprises reducing the effects of stress such as drought and/or heat stress.
[00108] [00108] The term "plant" as used herein refers to a member of the Reino Plantae and includes all phases of the plant life cycle, including, without limitation, seeds. In one modality, the plant is a cereal (wheat and barley), a legume (peas, lentils or chickpeas), flax, canola or plants.
[00109] [00109] In one embodiment, the seed is coated with the endophyte, cultivated with the endophyte or planted close to the endophyte. In a fashion-
[00110] [00110] In another aspect, there is provided a method of improving plant health and/or plant yield comprising treating plant propagation material or a plant with an endophyte or crop disclosed herein, or a combination or mixture of the themselves, or with a composition disclosed herein; and cultivating the plant propagation material into a first-generation plant or allowing the plant to grow.
[00111] [00111] The term "plant propagation material" as used herein refers to any part of the generative/sexual and vegetative/asexual plant that has the capacity to be cultivated in a young plant. In one embodiment, the plant propagation material is seed, seed or flower, and vegetative stem, cut, root, bulb, rhizome, tuber, vegetative shoot, or leaf parts.
[00112] [00112] In one embodiment, the isolated endophyte or culture thereof is an isolated endophyte of the Streptomyces sp strain. or culture thereof that is deposited with the International Depositary Authority of Canada (IDAC, National Microbiology Laboratory. Public Health Agency of Canada. 1015 Arlington Street, Winnipeg, Manitoba, Canada, R3E 3R2) accession number 081111-06 or that comprises the 16S rDNA sequence as shown in SEQ ID NO: 6; an isolated endophyte of Paraconyothirium sp. or culture thereof which is deposited as IDAC accession number 081111-03 or which comprises the sequence ITS rDNA, as shown in SEQ ID NO:5; an isolated endophyte of Pseudeurotium sp. or culture thereof which is deposited under IDAC accession number 081111-02 or which comprises the sequence ITS rDNA, as shown in SEQ ID NO: 4; an isolated endophyte from Penicillium sp. or culture thereof which is deposited under IDAC accession number 081111-01 or which comprises the sequence ITS rDNA as shown in SEQ ID NO:3; an isolated culture of Cladosporium sp. which is deposited under accession number IDAC 200312-06 or which comprises the sequence ITS rDNA as shown in SEQ ID NO: 1, and/or an isolated endophyte of Cladosporium sp. or culture thereof which is deposited under IDAC accession number 200312-05 or which comprises the sequence ITS rDNA as shown in SEQ ID NO:2.
[00113] [00113] In another modality, the methods reduce the effects of stress such as heat, drought and/or biotic stress.
[00114] [00114] In one modality, the methods enhance landscape development and repair.
[00115] [00115] Therefore, in one embodiment, a method of phytoremediation or phytorecovery from a contaminated site is provided, comprising treating propagating material of the plant or a plant with an endophyte or culture disclosed herein, or a combination mixing the same or a composition described herein, and cultivating the propagation material in the first-generation plant or allowing the plant to grow; thus recover or the location.
[00116] [00116] The term "phytoremediation" as used herein refers to the use of plants for the removal, reduction or neutralization of substances, or residues of hazardous material from a location, so as to avoid or minimize any adverse effects about the environment. The term "phytorecovery" as used herein refers to the use of plants to reconvert disturbed land to its previous or other productive uses.
[00117] [00117] In one modality, the location is the ground, such as in a landfill. In one embodiment, the hazardous substances, wastes or materials comprise hydrocarbons, petroleum or other chemical substances, salts or metals such as lead, cadmium or radioisotopes.
[00118] [00118] The phrase "treatment of plant propagation material
[00119] [00119] The plant can be any plant. In one embodiment, the plant is a cereal (eg wheat or barley), legume (eg peas, lentils or chickpeas), flax, rapeseed, coniferous tree (eg spruce or pine), tree broadleaf (eg willow or poplar), shrub (eg caragana or winterfat ) or grass (eg fescue or wild rye).
[00120] [00120] The above invention generally describes the present application. A fuller understanding can be gained by referring to the following specific examples. These examples are described for illustrative purposes only and are not intended to limit the scope of the disclosure. Changes in the form and replacement of equivalents are contemplated as circumstances may suggest or make it expedient. Although specific terms have been used herein, these terms are intended in a descriptive sense and not for purposes of limitation.
[00121] [00121] The following non-limiting examples are illustrative of the present invention:
[00122] [00122] Dormancy and germination depend on various processes and factors. To ensure seedling establishment and success, it is important to control the underlying processes or conditions. The role of plant genetics, hormones and different seed tissues has been relatively well studied. The present examples study the relationship of plant endophyte-seeds, transitioning from a symbiotic phase of the root towards plant maturation. Example 1 Taxonomy
[00123] [00123] International Depository Authority of Canada - IDAC (original strains deposited) and Saskatchewan Microbial Collection and Database - SMCD strains (copies of deposited strains): IDAC 081111-06 = SMCD 2215; IDAC 081111-03 = SMCD 2210; IDAC 081111-02 = SMCD 2208; IDAC 081111-01 = SMCD 2206; IDAC 200312-06 = SMCD 2204; IDAC 200312-05 = SMCD 2204F (Figures 1-6 and Table 1).
[00124] Strain SMCD 2215 was originally isolated as endophytic bacterium SMCD fungus from plant Phyalocephala sensu lato . Classification according to Labeda et al. [2012]. This phylogenetic study examines almost all described species (615 taxa) within the Streptomycetaceae family on the basis of 16S rDNA gene sequences and illustrates the species diversity within this family, which is observed to contain 130 statistically supported clades.
[00125] The present 16S rDNA sequence data confirm that strain Streptomyces sp. SMCD 2215 can be assigned to a separate unknown clade according to Labeda et al [2012], but separate species of Streptomyces lividans. Example 2 Microbe-plant symbiotic association and level of compatibility
[00126] [00126] The level of microbe-plant compatibility was assessed using a slightly modified method from Abdellatif et al. [2009]. On a 10 cm bicompartmental agar plate without nutrients (Figure 7), plant health and the formation of root hairs - the absorbents of water and minerals - were characterized in co-culture, with and without microbial partners. In Figure 7, the left compartment of each separation plate shows a culture with the microbial partner, and the right compartment of each separation plate shows a culture without the microbial partner. The experiment was repeated twice in three repetitions.
[00127] [00127] As shown in the left compartment of each separation plate, healthy plant tissue formed even when plant roots were cultivated directly on the dense microbial materials. Root hair biomass is increased to about twice as much compared to the right compartment of each division plate in which the microbial partner is absent (see left compartment).
[00128] [00128] The effectiveness of the plant to establish symbiotic association is dependent on the type of distribution of the endophytes within the root endoderm. Typical endophytic root colonization is discontinuous and partial with a lower number of occupied cells <50% (Table 2) compared to colonization of pathogenic fungi which is characterized by a uniform/continuous cell colonization (frequency: 60- 80%) (Figure 8).
[00129] [00129] The performance of an endophyte should not only be evaluated by measuring the production of biomass, because what underlies the visibly higher yield is the efficiency of the endophyte in the colonization of the plant. This can be assessed by characterizing their association with plant cells, tissues or organs (i.e., seeds and radi- cles) using mathematical indices that have been developed [Abdelatif et al. 2009] and applied in this study (Figure 9 and Figure 10).
[00130] [00130] These indices are based on the following observations: Endophytic symbionts show different patterns of root colonization (root) (regularity or level of deviation in the shape of the endophyte cell - Ireg and direction- Idir when colonizing living cell) in compared to dead root cells (which usually remain colonized by true saprophytes).
[00131] [00131] High Ireg and Idir index values determine the mutualistic (beneficial) plant-symbiont relationships. In conclusion, the results show that the microbe-plant symbiotic association is characterized by a high level of compatibility between the two partners, leading to balanced (<50% of colonized cortex cells) and discontinuous root colonization by the Microbial endophytes measure using mathematical indices [Abdellatif et al. 2009]. This mutualistic partnership is further characterized by the direct effect of endophytic microbes on healthy plant growth (bac- to- and mycodependency), when the plant is challenged to use microbial partners as the only source of nutrients or energy for the growth. Furthermore, improvement in root hair biomass by endophytes was observed and measured even in roots in distal compartments of division plates in which microbial partners were absent, indicating a possible function of promoting systemic plant growth of the endophytes. Example 3 Symbiotic Endophyte Organs in Wheat
[00132] [00132] Each taxonomic group of endophytes establishes a unique type of mycovitalism, consequently forming different symbiotic organs. Characterization of mycovitalism was performed using the methodology of Abdellatif et al. [2009], which consists of in vitro seed and microbe co-cultures evaluating an initial phase of the microbe-plant symbiotic association. The diversity of microbial symbiotic organs formed by SMCD 2204, 2206, 2210, and 2215 in wheat germinants is shown in Figure 11.
[00133] [00133] In summary, the results show differential types of symbiotic organs formed in the wheat root by each proving endophyte.
[00134] Symbiosis at the seed level resulted in an increase in wheat germinants after 10 days of co-inoculation (Figure 12 and Figure 13). Example 4 Endophytes improve wheat seed germination under heat stress and drought
[00135] [00135] Seed germination is a critical life stage for plant survival and timely seedling establishment especially in stressful environments. It is postulated that endophytes would improve wheat seed germination under heat stress and drought. The germination hydrothermal time (HTT) model is a useful conceptual model for predicting the germination time and energy (GE) within the scope of a given set of conditions. The HTT and EG are applied to determine whether one or more compatible endophytes improve heat or drought tolerance in wheat. Tested endophytes dramatically increased germination percentage, improved EG and HTT values, and decreased wheat susceptibility to heat and drought, as measured by seedling fresh weight. When colonized by the most effective endophyte, the values of the parameters tested in wheat seeds exposed to heat stress were similar to those in non-stressed seeds. Materials and methods
[00136] [00136] The hydrothermal time model (HTT) [Gummerson 1986] postulates that an individual seed begins to germinate when two conditions are met. First, the sum of daily temperatures, above a cardinal minimum value (minimum T ), accumulated over a period of time, must pass a threshold value (θ T ), measured in degrees days. Second, the seed must accumulate sufficient water potential (θ H ) per degree day. Thus, HTT (θ HT ) can be expressed as:
[00137] [00137] θHT = (θH)(θT). (Equation 1)
[00138] [00138] According to Köchy Tielbörger and [2007],
[00139] [00139] θ T = (T substrate - T min ) t (Equation 2)
[00140] [00140] with t representing elapsed time in days, and
[00141] [00141] θ H = ψ substrate - ψ min (Equation 3)
[00142] [00142] in a constant environment assuming that T substrate is equal to or less than the ideal temperature for seed germination. In equation 3, ψ substrate and ψ min represent the substrate water potential and the minimum water potential at which germination is possible, in MPa, respectively. Consistent with Bradford [2002], equations 2 and 3 can be substituted into equation 1 to generate:
[00143] [00143] θHT = (ψsubstrate - ψmin)(Tsubstrate - Tmin) t (Equation 4).
[00144] [00144] However, in the present study, the temperature exceeds the ideal temperature for wheat germination [reviewed by McMaster (2009)], which requires consideration of a maximum temperature (T max ) above which germination may not to occur. Thus, equation 2 was modified to:
[00145] [00145] θ T = √ [(T substrate - T min ) (│T substrate - T max │)] t (Equation 5)
[00146] [00146] where T min ≤T substrate ≤T max . If equation 5 is replaced by 2 in equation 4, the following results:
[00147] [00147] θ HT = (ψ substrate -ψ min ) √ [(T substrate - T min ) (│T substrate - T max │)] t (Equation 6)
[00148] [00148] where T min ≤ T substrate ≤ T max .
[00149] [00149] Germination energy (GE) can be defined in several ways, including the percentage of seeds that germinate after a certain period of time after planting, in relation to the number of seeds tested [Ruan et al. 2002; Dong-dong et al. 2009], or 50% of germination achieved [Allen 1958]. In order to integrate EG with the HTT germination model, the last definition was used, which means that EG is equal to T in Equation 2. Parameter estimation
[00150] [00150] The estimate of T min and T max for wheat was based on both the information available in the literature and the present inventors' own observations. McMaster [2009] summarizes data from Friend et al. [1962], Cao and Moss [1989], and Jame et al.
[1998] [1998], which indicates the existence of a curvilinear relationship between wheat development rate and temperature. Since wheat germination and development do not occur below 0ºC or above 40ºC, T min and T max were assigned the values of 0ºC and 40ºC, respectively.
[00151] [00151] The ψmin parameter was estimated in vitro by germinating wheat seeds grown on potato dextrose agar (PDA; Difco) as a medium containing a range of concentrations of polyethylene glycol (PEG) 8000 (Amresco Inc.). The water activity (a w ) of PDA alone and PDA containing 8%, 12% and 16% PEG was measured using AquaLab 4TE, Series 4 Quick Start, Decagon Devices. The water activity was converted to the water potential (ψ) using the adapted relationship of Bloom and Richard [2002]:
[00152] [00152] Ψ = [(RT) ln (a w )]/V (Equation 7)
[00153] [00153] where R is the universal gas constant (8.314 mol J -1 K -1
[00154] [00154] The aquatic activities of PDA and PDA containing 8%, 12% and 16% of PEG were 0.9974, 0.9890, 0.9863, and 0.9825, respectively. These values are equivalent to - 0.35, - 1.51, - 1.88 and - 2.41 MPa, respectively, and are consistent with those reported in the literature [Leone et al. 1994]. Plant and fungal material
[00155] [00155] The plant material used was the hard wheat cultivar AC Avonlea, which has low resistance to environmental stressors[SaskSeed guide 2008]. The seeds used in the first round of experiments were produced by Paterson Grain in 2008, under field conditions, and not certified as free from microbes. Seeds used in the second set of experiments were produced by Agriculture and Agri-Food Canada (AAFC) Seed Increase Unit Research Farm in 2006 under greenhouse conditions, and were certified to be free of microbes. Wheat seeds were surface sterilized with 95% ethanol for 10 s, rinsed in sterile distilled water for 10 s, or submerged for 3 min (first round of experiments involving seeds not certified as microbial free) or 1 min (second round of experiments with seeds certified as free of microbes) in 5% sodium hypochlorite (Javex), washed three times in sterile distilled water and PDA for germination [Abdellatif et al. 2009]. A third method of seed sterilization, involving a 3 h exposure to chlorine gas (produced by combining 25 mL of 6% sodium hypochlorite with 1.0 mL of concentrated hydrochloric acid in a beaker) in a closed plastic box placed in an exhaust fan [Rivero et al. 2011 ] was also tested. The germination percentage of seeds subjected to each sterilization protocol and placed in PDA for three days is shown in Figure 14B. Only submersion in sodium hypochlorite for 3 min resulted in a significant decrease in germination (p ≤ 0.01). Surface sterilization of seeds was intended to eliminate microbes that may compete with the endophytes being investigated. Furthermore, microbes present on the surface of the seeds can cover the plaque and emerging seedlings, inhibiting plant growth. All seeds used in the study were determined to be free of microorganisms after sterilization, based on the absence of unintentional microbial growth on the plate.
[00156] [00156] Four endophytic Ascomicota mitosporic fungal isolates (classified according to Kiffer and Morelet [2000]): SMCD 2204, SMCD 2206, SMCD 2208 and SMCD 2210, plus the filamentous gram positive bacterial isolate Actinomycetes SMCD 2215; compatible with Triticum turgidum L. [Abdellatif et al. 2009] were used in this study. Endophytes were cultured in PDA for at least three days at room temperature in the dark before experimental use. Endophytes as free-living organisms
[00157] Agar plugs (5 mm 2 ) cut from the margins of the parent colony were placed in the center of a 90 mm Petri dish containing PDA alone or altered with 8% PEG (dry). The Petri dish was sealed with parafilm (Pechiney Plastic Packaging) to maintain sterility and placed in a benchtop incubator (Precision Thermo Scientific, model 3522) at 23°C, or under heat stress, 36°C, in the dark. Colony diameter was measured at 24, 48, 72, 96 h, and five and six days. Diameter changes were used to calculate colony growth rate. The growth of a minimum of three replicates per isolate was measured. Ability of endophytes to impart heat and drought tolerance to wheat
[00158] [00158] Each isolate was applied individually to wheat seeds prior to germination according to the method described in Abdel-latif et al. [2010] and shown in Figure 14A. Briefly, five surface sterilized seeds were placed at a distance equivalent to 48 h of 5 mm 2 agar plug hyphae growth, hyphae placed side down in the center of a 60 mm Petri dish. For slow-growing isolates, the endophyte colony agar plug was placed in the Petri dish one to four days prior to seed introduction. The seedlings were germinated for one week under abiotic stress and control conditions.
[00159] [00159] Drought was induced using PDA containing 8% PEG. Thermal stress was induced in a benchtop incubator in the dark; the temperature was gradually increased by 2°C every 2 h from 28°C to 36°C. In the first round of experiments, germination percentage at three days and fresh weight at one week were evaluated. Each experiment consisted of six Petri dishes and was independently repeated three times. In further experiments, germination percentage was evaluated every 24 hours for seven days. Each experiment consisted of 10 Petri dishes and was repeated twice (combined heat and water stress) or three times (thermal stress, water stress and control conditions).
[00160] [00160] The stable internal colonization of wheat roots by the desired endophytes was confirmed by re-isolation of the endophyte organism from roots that had been surface sterilized to remove an external microbial growth, using a procedure modified from Larran et al. [2002]. Root fragments (~0.5 cm) were surface sterilized in 95% ethanol for 10 s.
[00161] [00161] The growth rates of colonies of free-living endophytic organisms cultivated under heat or drought were compared with those of the same organism cultivated under control conditions by means of analysis of variance (ANOVA) followed by the post-hoc test of Fischer's least significant difference (LSD). Germination percentage data were subjected to arcsine transformation before statistical analysis [McDonald 2009]. Statistical differences between percentage germination after both three and seven days, and fresh weight at seven days were evaluated using a single ANOVA factor to compare all treatments. Subsequently, a post-hoc LSD test was used to assess the significance of differences between the control without endophyte and seeds treated with each mycobiont. The level of statistical significance associated with the differences between GE and HTT required to achieve 50% germination of seeds colonized with endophytes and control was assessed by evaluating the GE for each of the three independent replicates of the experiment. The resulting data were subjected to an analysis of variance and post-hoc LSD analysis. P values less than 0.05 and 0.01 were considered significant and highly significant, respectively. Statistical tests were performed with SPSS Inc. 2011. Results
[00162] [00162] Within each section, the results are organized according to the type of stress: heat, drought, heat and drought, or no stress. Within each stress, the results dealing with plant material are presented according to the germination and/or seedling traits measured: germination percentage in three and seven days, fresh mass at seven days, EG and HTT. free-living endophytes
[00163] [00163] The SMCD phenotypes 2206, 2210 and 2215 were not altered by heat (36ºC), while SMCD 2204 and 2208 did not grow at 36ºC. The growth rates of SMCD 2206 and 2210 colonies were reduced at 36°C compared to unstressed conditions (p ≤ 0.01) while the growth rate of SMCD 2215 at 36°C was increased (p ≤ 0 .05) (Figure 15). At 36°C SMCD 2215 grew faster, followed in descending order by 2206 and 2210 (Figure 15).
[00164] [00164] The morphology of SMCD 2204, 2206, 2208 and 2215 was not noticeably altered by drought (8% PEG). However, when SMCD 2210 was exposed to drought, this organism lost its "woolly" appearance and instead acquired a "shiny" or "sticky" appearance. The colony growth rates of SMCD 2204, 2206, and 2208 were reduced by drought (p ≤ 0.01, p ≤ 0.01, and p ≤ 0.05, respectively), while the colony growth rate of all other endophytes remained unchanged (Figure 15). When water stress was applied, SMCD 2204 grew at the highest rate, followed in descending order by 2206, 2210, 2208, and 2215 (Figure 15).
[00165] [00165] When challenged by 36°C heat and dry (8% PEG) at the same time, SMCD 2204, and 2208 failed to grow, while SMCD 2206, 2210 and 2215 grew at a significantly slower rate than under control conditions ( p ≤ 0.01) (Figure 15). Under control conditions, SMCD 2204 grew faster, followed in descending order by SMCD 2206, 2210, 2208, and 2215 (Figure 15).
[00166] [00166] At 36ºC, colonization by SMCD 2206 and 2215 increased germination after three days (p ≤ 0.05 and p ≤ 0.01, respectively; Figure 16A), while SMCD 2204, 2208 and 2210 did not change this parameter (p> 0.1; Figure 16A). After seven days, 63% and 56% of seeds germinated in co-culture with SMCD 2204 and 2208, respectively. These values were not statistically different (p> 0.1) from the 59% germination achieved by the non-colonized control. In contrast, endosymbionts SMCD 2206, 2210, and 2215 promoted germination after seven days (p ≤ 0.01; Figure 17).
[00167] [00167] When subjected to 36ºC, the fresh weight of wheat seedlings was stable in co-culture with SMCD 2204, 2206, 2208 and 2210, while SMCD 2215 significantly increased this parameter (p ≤ 0.01, respectively; Figure 16D).
[00168] [00168] The GE of wheat seeds co-cultured at 36ºC with endophyte fungus SMCD 2210 (p ≤ 0.05; Table 3, Figure 17) improved compared to endophyte-free seeds. However, SMCD 2204, 2206, 2208 and 2215 did not change EG (p> 0.1; Table 3) in relation to the control. SMCD 2210 increased GE to the greatest extent, followed by SMCD 2206 and 2215 (Table 3). SMCD 2210 reduced the time needed for 50% of seeds to germinate in just two days.
[00169] [00169] When exposed to heat stress, the HTT required for germination was reduced for wheat seeds colonized by SMCD 2210 (p ≤ 0.05; Table 3), but not for any other endophytes tested (p > 0 ,1; Table 3). Endophyte-free wheat seeds required 50 MPa °C days longer than seeds colonized by SMCD 2210 (the most effective endophyte tested) to achieve 50% germination (Table 3). There was a clear, negative, linear correlation between the HTT required for 50% germination and germination percentage after seven days under heat stress (Figure 18).
[00170] [00170] When subjected to drought stress for three days, a reduced percentage of wheat seeds germinated in co-culture with SMCD 2208, compared to endophyte-free seeds (p ≤ 0.01; Figure 16B), while SMCD 2204, 2206, 2210, 2215 did not change this trait (p>0.1; Figure 16B). After seven days, treatment with SMCD 2206, 2210 and 2215 led to an increase in seed germination (p ≤ 0.01, p ≤ 0.05, and p ≤ 0.01, respectively; Figure 17). In contrast, 65 and 67% of seeds co-cultivated with SMCD 2204 and 2208 had germinated after seven days. None of these values were statistically higher than the 59% of uncolonized seeds that germinated under the same conditions (p>0.1). Under drought conditions, SMCD 2208 and 2210 decreased fresh weight after seven days (p ≤ 0.05 and p ≤ 0.01, respectively; Figure 16E). None of the other mycobionts changed this parameter (p> 0.1; Figure 16E).
[00171] [00171] EG decreased for wheat seeds co-cultivated under drought conditions with all endophytes tested, compared to endophyte-free seeds (0.05 < p ≤ 0.1 for SMCD 2204 and 2208 and p ≤ 0.05 for 2206, 2210 and 2215; Table 3). SMCD 2206 improved GE to the greatest extent, reducing the time elapsed before 50% germination was reached after 2.6 days (Table 3, Figure 17).
[00172] [00172] The HTT required for germination was reduced for wheat seeds treated with all endophytes tested under water stress (Table 3). While uncolonized seeds needed 80 MPa ºC days to reach 50% germination, seeds colonized by endophyte SMCD 2206 (the most effective endophyte tested) needed only 34 MPa ºC days, which represents a drop of 46 MPa °C day (Table 3). There was a visible, negative, linear correlation between the HTT required for germination of 50% and the percentage of germination in seven days under water stress (Figure 18). However, the R value associated with this linear relationship was lower than for the correlation found in heat stress. The HTTS ranges necessary to reach 50% of germination differ between heat and water stress, with values between 34 and 44 MPa ºC days and 80 and 94 MPa ºC day being unique for seeds exposed to drought and heat stress, respectively ( Figure 18; Table 3). Percent germination ranges after seven days are similar between seeds exposed to drought and those subjected to heat, although the germination levels of heat-stressed seeds covered a somewhat wider range (Figure 18). Response of endophyte-colonized wheat to drought and heat in combination
[00173] [00173] Very few wheat seeds germinated when exposed to drought (8% PEG) and heat stress (36°C) simultaneously (Figure 17). Colonization by endophytic microorganisms SMCD 2210 and 2215 increased the percentage of germination after seven days (p ≤ 0.01; Figure 17). On the other hand, SMCD 2204, 2206 and 2208 failed to improve this trait (p>0.1). Seeds co-cultivated with SMCD 2215 (the most beneficial microorganism for this parameter tested) reached 24% germination, four times the level reached by their endophyte-free counterparts (Figure 17).
[00174] [00174] Because neither uncolonized seeds nor those colonized by any of the endophytes reached 50% germination within seven days, EG could not be determined and HTT was calculated for 5% rather than 50% germination. The time needed to reach 5% germination ranged from 24 h to four days. None of the tested endophytes decreased the time needed to reach 5% germination or HTT values (p>0.1). Overall, the HTT required to reach 5% germination ranged from 11 to 43 MPa ºC day (mean HTT = 23.9) (Figure 18; Table 3).
[00175] [00175] The range of values for HTT for seeds subjected to heat stress and drought was unique compared to the HTT values when heat or drought was applied alone. There was a negative linear relationship between required HTT and the percentage of germination in combined heat and drought stress. However, the R2 value associated with this linear relationship was lower than for the correlation found when neither heat stress nor drought was applied individually (Figure 18). Response of endophyte colonized wheat to control conditions
[00176] [00176] Under non-stressful conditions, SMCD 2215 significantly increased seed germination compared to uncolonized seeds after three days (p ≤ 0.01) (Figure 16C). SMCD 2206, 2208 and 2210 had a positive impact, while SMCD 2204 did not change germination percentage. Under non-stressful conditions, SMCD 2204, 2210 and 2215 increased the fresh weight of wheat seedlings after seven days (p ≤ 0.05 and p ≤ 0.01, respectively). Furthermore, SMCD 2206 and 2208 showed no impact on fresh mass compared to uncolonized seedlings (Figure 16F).
[00177] [00177] Under control conditions, HTT and EG parameters were slightly improved by SMCD 2206 and 2215 endosymbionts (Table 3). Relatively little change in EG and HTT parameters was measured associated with unstressed wheat seeds co-cultured with different isolates. Example 5 Endophytes improve the production of wheat and barley genotypes under severe water stress
[00178] [00178] Summary: Due to climate change and population growth, the development of techniques to increase tolerance of crops in agriculture in stressful environments is critical. The inno-
[00179] [00179] Seeds of cultivars of wheat and barley were produced in experimental fields at the University of Saskatchewan and Crop Science Field Laboratory (Saskatoon). Visually healthy seeds were surface sterilized in 95% ethanol for 10 s, washed in sterile distilled water for 10 s, submerged for 1 min in 5% sodium hypochlorite (Javex) and then rinsed three times in sterile distilled water.
[00180] [00180] The endophytic isolates used in this study were originally isolated from the roots of durum wheat Triticum turgidum L. cultivated in field sites in Saskatchewan, Canada [Vujanovic 2007b]: SMCD 2204, 2206, 2208, 2210, 2215. All endophyte isolates are cultivable on potato dextrose agar (PDA; Difco) in the absence of a host plant. The isolates were cultivated in PDA for three days at room temperature (23ºC) in the dark before experimental use.
[00181] [00181] The experimental inoculations were made in pots. Each of the endophytic isolates was applied to cereal seeds (wheat and barley) before germination according to the method described in Abdellatif et al. [2010]. Briefly, five surface sterilized seeds were positioned at a distance equivalent to 48 h of agar plug hyphae growth ± 5 mm 2 , hyphae placed side down in the center of a 2 L plastic pot filled with 300 grams ( dry weight) of planting soil mix Sunshine 4 with autoclaved field capacity. The seeds and agar plug were then covered with a 3.5-4.0 cm layer of Sunshine mixture.
[00182] [00182] The water stress was induced from May to September, when the maximum night-day temperatures in the greenhouse ranged from 18 to 26 ºC. On sunny days, natural sunlight provided irradiation, while on cloudy or winter days with a shorter photoperiod, 1000 watts of high-pressure sodium lamps, suspended from the ceiling approximately 2 m above the plants, supplemented the light. solar. In the first experiment, drought-stressed and control (well-watered) plants were grown at 25% soil water content by weight and 100% water holding capacity, respectively. During the experiment, the control plants were watered at 100% water holding capacity three times a week, while the plants subjected to drought were watered at 100% water holding capacity weekly . This drought regime was adopted in order to mimic the natural cycle of drought that can occur during the growing season in North American grasslands [Chipanshi et al. 2006].
[00183] [00183] Mature ears were collected and dried grains weighed on a Mettler Toledo PG802-S scale in the laboratory. Results and discussion Increased wheat seed germination vigor (SGV)
[00184] [00184] Under in vitro control conditions, wheat seeds treated with SMCD (2204, 2206, 2208, 2210, 2215) germinated consistently faster, more uniformly, and with much higher SGE (seed germination efficiency ). The SGV of seeds inoculated with SMCD (E+) was 15% to 40% higher compared to untreated (E-) seeds (Figure 19), demonstrating the efficacy of SMCD in controlling seed dormancy and increasing seed dormancy. seed vigor. The positive effects of SMCD strains on the yield of wheat and barley genotypes under severe drought were also demonstrated.
[00185] [00185] Barley genotypes generally show greater susceptibility to drought (low DTE (Drought Tolerance Effectiveness) values) and lower yields than wheat (Table 4), possibly due to extreme drought conditions in the country. greenhouse best suited to wheat. In particular, two-row CDC Kendall barley, without endophyte (E-), has a high susceptibility to water stress compared to other barley genotypes. However, endophyte treatments (E+) demonstrate a positive effect on the remarkable yield of all genotypes (Table 4). Entrusted resistance ranges from CDC Kendall with low drought resistance to highly resistant New Dale genotypes, while imparted resistance to wheat was consistently high.
[00186] [00186] During the maturity stage of wheat and barley, SMCD endophytes dramatically increase drought genotype tolerance parameters such as DTE efficacy and yield. SMCD application in Avonlea, the most drought-susceptible wheat cultivar detected (DTE =
[00187] [00187] In conclusion, combining drought resistant genotypes with compatible endophytic SMCD 2206, SMCD 2210, and SMCD 2215 from microbial symbionts maximizes plant resistance to drought, an important aspect in ensuring food security. Without wishing to be bound by theory, this suggests that the wheat (Figure 19A) and barley (Figure 19b) cultivars most susceptible to drought (low DTE values) will have the most symbiotic association when exposed to water stress.
[00188] [00188] The only exception seems to be the six-row Legacy barley genotype showing an extremely low TTE = 1.1. Although they responded positively to the presence of endophyte with a higher yield of 26.9% under control conditions, this yield improved only to 5% in symbiosis under stress. Thus, this cultivar was excluded from the barley model shown in Figure 19B.
[00189] [00189] Effect of individual SMCD strains on wheat and barley yield
[00190] [00190] Individual SMCD strains positively affect the average grain yield of each genotype, although the actual magnitude varies according to the genotype-strain combination. Figure 21 presents the results obtained under dry conditions in an oven (Figure 21: A - wheat; B a -barley (two rows), and B b -barley (six rows)).
[00191] [00191] Early seed contact with compatible SMCD isolates is a prerequisite for crop protection against drought, resulting in higher yield or grain production. SMCD 2206 generally confers the highest degree of improvement for most genotypes. However, strain-cultivar specificity guarantees greater individual improvements, eg Wheat-PT580 and barley-CDC Copeland prefer SMCD 2210; while Wheat-BW423 and PT580 as well as CDC Kendall show higher performance and drought resistance when inoculated with SMCD
[00192] [00192] The results highlight the importance of mycovitalism in stress-challenged wheat and barley seeds, helping breeders to produce highly productive cultivars capable of withstanding drought conditions significantly better than any single cultivar ( Figure 22: AD). After demonstrated performance of SMCD strains in fields, growers will have green symbiotic products to ensure crop yields, and agribusiness will benefit from a guaranteed level of positive crop results regardless of fluctuations in environmental conditions. Example 6 Fitotron heat stress experiment in legumes
[00193] [00193] This experiment was conducted under phytotron conditions. All seed varieties were inoculated with endophytes (SMCD 2204F, SMCD 2206, SMCD 2210, and SMCD 2215) and without endophytes in pots containing the soil mixture. Details of the approaches used to inoculate endophyte into the plant are described above in Example 5. Pots with heat stress plants were placed in a Conviron PGR15 phytotron growth chamber (Controlled Environments Ltd.) using a random block design. - tories. A temperature of about 33°C was selected for heat stress. The plants were exposed to this temperature for 8 hours, after which the plants were exposed to a temperature of 21 0 C for 16 hours to 10 days. After the thermal shock, the temperatures were changed to 16 0 C for 8 hours and 21 0 C du-
[00194] [00194] In summary, the results show that the efficacy of each endophyte tested in conferring tolerance to heat stress is related to the genotype of the particular plant or host variety (A-chickpea, B-lentil, and C-pea), and that the increase in biomass is associated with a particular plant organ in which each organ: pod (Figure 23), stem (Figure 24) and root (Figure 25), is differentially affected. by heat stress.
[00195] [00195] SMCD 2215 mostly improved stem and pod biomass in peas and root biomass in chickpeas. SMCD 2206 increased stem and pod biomass in lentils and root biomass in chickpeas, peas, and lentils. SMCD 2210 improved mostly stem and pod biomass in chickpeas and root biomass in pea. SMCD 2204F improved pod biomass in most crops tested (chickpeas, peas, and lentils). The best combination of endophyte-performing crop (E+) showed an improvement of about 300% in pod, stem and root biomass compared to heat-stressed control without endophyte (E-).
[00196] [00196] Stem: The following endophytes showed the best response to heat stress: Chickpea: Amit: SMCD 2210. Vanguard: SMCD 2204F; Pea: Golden: SMCD 2215. Handel: SMCD 2215; and Lentil: Glamis: SMCD 2206. Sedley: SMCD 2206.
[00197] [00197] Pods : The following endophytes showed the best response to heat stress: Chickpea: Amit: SMCD 2210. Vanguard: SMCD 2204F; Pea: Golden: SMCD 2204F. Handel: SMCD 2215; Lentil: Glamis: SMCD 2206. Sedley: SMCD 2204F.
[00198] [00198] Root : The following endophytes showed the best response to heat stress: Chickpea: Amit: SMCD 2215. Vanguard:
[00199] [00199] Six seed varieties [Amit, Vanguard (chickpeas), Golden, Handel (peas) and Glamis, Sedley (lentils)] and endophytes SMCD 2204, SMCD 2204F, SMCD 2206, SMCD 2210, and SMCD 2215 were used in this study. These experiments were carried out in a greenhouse. After sowing seed and inoculating endophytic microorganisms, pots were left without water for 14 days to mimic severe drought, as proposed by Charlton et.al. [2008] and according to the methodology and conditions described by Gan et al. [2004]. Results
[00200] [00200] In summary, the results show that each of the SMCD strains positively affects several agricultural parameters on the production or yield of pods (Figures 27), and the biomass of stem (Figures 26) and root (Figures 28) ) in chickpeas (A), peas (B), lentils (C) and under water stress. Overall, crop genotypes colonized by symbiotic endophyte (E+) became more resistant to drought stress vs. by heat. The level of effectiveness of the tested endophytes in conferring drought tolerance varied with the particular plant organ: pod production was highly improved in Glamis by SMCD 2204, in Vanguard by SMCD 2204F, in Sedley by SMCD 2206, in Golden by SMCD 2210 , and in Handel by SMCD 2215.
[00201] [00201] Stem: The following endophytes showed the best response to water stress: Chickpea: Amit: SMCD 2204F, Vanguard: SMCD 2206; Pea: Golden: SMCD 2204, Handel: SMCD 2204; SMCD 2210; SMCD 2215; Lentil: Glamis: SMCD 2204F; SMCD
[00202] [00202] Pods: The following endophytes showed the best response to water stress: Chickpea: Amit: SMCD 2204; SMCD
[00203] [00203] Root: The following endophytes showed the best response to water stress: Chickpea: Amit: SMCD 2204; SMCD 2215. Vanguard: SMCD 2204F; SMCD 2206; Pea: Golden: SMCD 2204F; SMCD2215. Handel: SMCD 2204F; Lentil: Glamis: SMCD 2204F; SMCD 2206; SMCD 2210. Sedley: SMCD 2206; SMCD 2210. Example 8 SMCD 2215 from Streptomyces sp. increases Rhizobium activity and nodulation frequency in heat stress peas
[00204] [00204] As was recently observed for another Streptomyces species, S. lydicus WYEC10 [Tokala et al. 2002], Streptomyces sp. Nov. SMCD2215 colonizes the roots of young pea seedlings from seeds produced from plants grown under control conditions. This specifically increases flowering and pod production (Figure 29), and root nodulation by Rhizobium sp. (Figure 30), a native pea seed colonizing endophyte discovered in this study (Table 5). Vegetative hyphae of Streptomyces sp. Nov. SMCD2215 colonizes cells from emerging nodules as discovered by culture dish (PDA), fluorescence microscopy ( Carl Zeiss Axioskop 2 ) and PCR (BioRad) as amplification methods [ Schrey and Tarkka, 2008] Example 9 Endophytes check Abiotic stress tolerance for legumes via enhanced seed viability
[00205] [00205] Pulse crops refer to a group of more than sixty different grain pulse crops grown throughout the world. Legume seeds are important for human nutrition. The main restrictions on legume production are biotic and abiotic stresses, such as drought, heat, cold and salinity. Recent research suggests that endophytic microbe-plant interactions are a key determinant of plant adaptation.
[00206] [00206] This study raises the hypothesis that endophytes increase the speed and uniformity of seed germination under ideal conditions and in vitro stress. The aim was, first, to measure the intrinsic symbiotic capacity of endophytes to trigger germination; and, secondly, to measure the efficiency of compatible endophytes in imparting heat and drought resistance to legume genotypes. Material and methods
[00207] [00207] Two legume grain varieties, Glamis (lentil) and Handel (pea), were co-cultivated with SMCD 2206 and compatible SMCD 2215, fungi and symbiotic bacterial strains, respectively. The ability of endophytic strains to confer stress tolerance on Golden (Figure 31) and Handel (Figure 32) genotypes was tested during in-vitro seed germination modeling drought (6% PEG) and heat (33oC) environments.
[00208] The seeds were surface sterilized with 95% ethanol for 20s, washed twice in sterile distilled water for 10 seconds, followed by 2 min in 3% sodium hypochlorite (Javex). Finally, the seeds were washed in sterile distilled water four times. Seeds were inoculated in PDA medium with and without endophytes in the dark at room temperature [Abdellatif et al. 2009]. Microbial organisms were cultured in PDA for at least three days at room temperature in the dark before experimental use. The endophytic capacity to provide plant resistance to stress was evaluated using germination energy, which is intended to capture the temporal nature of germination and which is defined as the number of days needed to reach 50% of germinating seeds. . Results
[00209] [00209] The present study demonstrates the differential ability of fungal or bacterial endophytes to provide resistance to drought and heat in specific legumes for a combination of bacterial strain or with the plant's genomic and abiotic stress. This study used molecular and proteomics analysis to better understand the mechanism by which endophytes confer resistance to symbiotic stress in legumes.
[00210] [00210] SMCD strains significantly increased the frequency of legume seed germination under standard in vitro conditions (Figure 33). Under stressful conditions, both endophytes (SMCD 2206 and SMCD 2215) increased the germination frequency when compared to non-colonized seeds. Germination frequency was 70-100% in symbiotic treatments and 60-80% germination in control, meaning that the endophytes tested had the potential to increase seed germination vigor (SGV) by > 15%. The highest germination frequency (100%) was observed in Glamis (lentil) associated with both SMCD 2206 and SMCD 2215 under water stress vs. heat stress. When co-inoculated with SMCD strains, germination energy (> 50% in germinating seeds) in Glamis was reached in 2 days under dry conditions and in 3 days under hot conditions. Similar results were obtained in Handel (pea), except that this genotype inherently has a greater capacity to withstand heat shock than Glamis (lentil). Example 10
[00211] [00211] The aim of this study was to use three randomly selected isolates (SMCD 2206, SMCD 2210 and SMCD 2215) and to expand the efficiency test in the yield of flax and canola production under water stress. Material and methods
[00212] [00212] The experimental design, manipulation of flax (Bethun and Sorel) and canola seeds (1768S), application of endophytic inoculants (SMCD 2206, SMCD 2210 and SMCD 2215), drought conditions, and yield evaluation they are as detailed in Example 5 with minor modifications. Briefly, control plants were watered at 100% water holding capacity three times a week, while drought-stressed plants were watered at 100% water holding capacity weekly. This drought regime was adopted in order to mimic the natural drought cycle that can occur during the Canadian prairie growing season in which no rainfall falls for seven consecutive days or more. Results and discussion
[00213] [00213] Severe drought conditions compromised non-symbiotic flax yield, while endophytic inoculants SMCD 2206 and SMCD 2210 dramatically improved flax yield under these same conditions. In particular, under drought conditions, SMCD 2206 maintains an almost 100% yield in Bethun while SMCD 2210 provides a 50% yield relative to the stress-free greenhouse control (Figure 34). SMCD 2210 (> 100%), followed by SMCD 2206 (~ 50%) and SMCD 2215 (~ 30%) compared to the no-stress control (Figure 35).
[00214] [00214] The bioprotection capacity was also tested in a greenhouse against Fusarium avenaceum and F. graminearum. Autoclaved seeds were infected by Fusaria inoculants in the dark for 7 days at 25°C (Figure 36), and were inoculated by endophytes produced in Petri dishes as described by Abdellatif et al. [2009].
[00215] Pot soil mix was inoculated with twenty seeds containing Fusarium. The composition of the mixed soil was 55-65% Canadian Sphagnum Peat Moss, Perlite and Limestone mixed with sand. Standard greenhouse conditions were 8h days of light exchanged with a 16h photoperiod (1000 lux) 70 % relative humidity and a constant temperature of 25°C ± 2 °C.
[00216] [00216] Plant treatments were as follows:
[00217] [00217] T1: Untreated plants (control) T2 : Plant + endophyte T3 : Plant + pathogen, Fusarium avenaceum T4 : Plant + pathogen , Fusarium graminearum T5 : Plant + endophyte fungus + Fusarium ave- naceum T6: Plant + endophyte + Fusarium graminearum
[00218] [00218] Each treatment was repeated in three pots, and seedlings were watered three times a week under controlled conditions. Root colonization by endophyte was tested using a fluorescence microscope to distinguish symbiotic vs. pathogenic endophyte- wheat [Abdellatif et al. 2009].
[00219] [00219] Figures 37-40 show the positive effect of endophytes on post-emergence wheat seedling resistance (Figure 37), foliage and root biomass (Figure 38 and Figure 39), and stage and flowering/anthesis peaks ( Figure 38, Figure 39, and Figure 40). All endophytes tested induced well-developed foliage compared to the control, as well as well-developed flowers in the presence of endophytes.
[00220] [00220] To confirm the ability of endophytes to stimulate mature plant growth in the presence of Fusarium pathogens, the performance of the flowering stage having the peaks was evaluated as a more advanced growth stage.
[00221] [00221] The histograms in Figure 41 illustrate the performance of endophytes in improving the biomass or dry weight of wheat ears after double inoculation (SMCD endophyte and Fusarium pathogen).
[00222] The wheat yield in the presence of an endophyte and Fusarium significantly improves using all endophytic strains compared to treatment infected with F. graminearum and F. avenaceum but without an endophyte (E-) (Figure 41). Plants treated with the pathogen alone show significantly smaller ear size compared to control plants and plants with endophytes (E+) (Figure 42). Example 11 Endophyte-Mediated Abiotic Stress Resistance Gene Expression in Legumes Abstract:
[00223] [00223] The genomic and proteomic mechanisms of beneficial effects of plant endophytes on host plant resistance to abiotic stress factors are poorly understood. One of the contemporary theories suggests that symbiotic plants are protected against oxidative stressors produced by heat, drought and salt by producing antioxidant molecules. The aim of this study is to shed more light on the defensive symbiosis of pea, chickpea and lentil genotypes by evaluating Pro, SOD and MnSOD gene expressions triggered by the association between host and endophyte genotypes. The results of this study demonstrated endophyte-mediated gene expression in plants inoculated with endophytes. These genes play an important role and provide host protection through improved stress tolerance to the tested abiotic stressors. Materials and methods
[00224] [00224] Leaves were collected for this analysis from 6 normal and stressed seed varieties (Amit, Vanguard [chickpeas] (Figure 43), Golden, Handel [eas] and Glamis, Sedley [lentils]) with or without endophytes.
[00225] [00225] Real-time PCR was used to amplify genes like proline (Pro), SOD and Mn SOD using primers as shown in SEQ ID NOs: 8-15 (Table 6), stress proteins are usually found playing special roles in protecting cytoplasm from dehydration and protecting plants by mitigating the toxicity produced by high concentrations of ions. PCR was conducted under the following conditions: 3 min at 95°C (enzyme activation), 40 cycles each of 30 seconds at 95°C (saturation) and 30 s at 60°C (annealing/extension). Finally, a melting curve analysis was performed from 65° to 95°C in 0.5°C increments, each lasting 5 s, to confirm the presence of a single product and absence of dimer. of initiator. Quantification is relative to the control gene by subtracting the CT of the control gene from the CT of the gene of interest (∆CT). The resulting difference in cycle number is then divided by the calibrator normalized target value, and the obtained value (∆∆CT) is the base exponent 2 (due to the doubling of the PCR function) to generate the relative expression levels. Results
[00226] [00226] The expressions of different genes during water stress were analyzed. Table 6 shows the genes that were tested. Some of the results obtained from the Handel variety when exposed to 6% PEG. SOD and MnSOD
[00227] [00227] In general, SODs play an important role in antioxidant defense mechanisms. In the present study, very high levels of SOD expression were observed in normal leaf
[00228] [00228] MnSOD is one of the forms of SOD. Control leaves showed a 16-fold increase in gene expression, whereas SMCD 2215 suppressed stress and decreased the fold shift from 16-fold to 2-fold, followed by SMCD 2206, SMCD 2210, and SMCD 2204 (Figure 44B). proline
[00229] [00229] Proline is essential for primary metabolism. Proline biosynthesis is controlled by the activity of the two P5CS genes in plants. This gene was evaluated in Handel variety pea with endophytes under dry condition. As expected, the P5CS gene was up-regulated and expression increased by 5 times in leaves collected from plants exposed to PEG. Whereas leaves collected from seeds associated with SMCD 2206 expressed 2.8 times, followed by SMCD 2215 in 3.4 times expressed gene encoding proline (Figure 45). These results confirmed that endophytes play an important role in stress resistance modifying the expression of the proline gene in comparison to non-inoculated stressed plants. Example 12 Gene Expression Patterns in Wheat Coleorrhyza under Cold and Biological Stratification Synthesis:
[00230] [00230] Wheat is one of the main crops widely used in the world. However, global wheat production has declined by about
[00231] [00231] Seeds of the hard wheat cultivar AC Avonlea with low resistance to environmental stress conditions were used in this study. These seeds were produced by Agriculture and Agri- Food Canada Seed Increase Unit Research Farm in 2006 in a greenhouse, and were recommended as free of microbes. Seeds were kept in sterile ziplock bags and stored in a cold room at 4 º C until use. Comparison of Seed Sterilization Protocols
[00232] [00232] Several methods have been proposed for surface sterilization of wheat seeds. Here four widely recognized seed sterilization methods were compared to identify the best suitable protocol that efficiently sterilizes seed surface without affecting seed quality and vitality in this wheat variety. In the first method, seeds were surface sterilized with 95% ethanol for 10 s, followed by washing in sterile distilled water three times for 1 min [Zhang et al., 2007. BMC Genetics 8]. The second protocol was bleach sterilization where seeds were surface sterilized in 5% sodium hypochlorite for 3 minutes, followed by thorough washing in sterile distilled water three times for 1 min. In the third protocol, the seeds were surface sterilized with 95% ethanol for 10 seconds, washed in sterile distilled water, then submerged in 5% sodium hypochlorite for 3 minutes, rinsed three times in distilled water sterile and placed on potato dextrose agar (PDA) for germination [Abdellatif et al. 2009]. The fourth method of sterilization was in the vapor phase of the seeds with chlorine gas [Desfeux et al., 2000]. In the exhaust chamber, a small beaker with 20 ml of whitener is placed in a 5 liter snaptite box. Wheat seeds were placed in a 96-well plate and kept in a snaptite box. Then 3 ml of concentrated hydrochloric acid was added to the small beaker to create chlorine gas. The lid was kept closed for 4 hours to keep the seeds in contact with chlorine gas. After sterilization, the 96-well plate was placed for 1 hour in a laminar flow chamber to disperse residual chlorine gas. Sterilized seeds were then washed three times in sterile distilled water and were plated on PDA plates. The comparison of these sterilization methods suggests that the chlorine gas sterilization protocol was the most effective method, showing 80% germination, without contamination, while the control seeds had a higher percentage of contamination (Table 7). Although bleaching and ethylic methods successfully inhibited contamination, seed germination was considerably affected. Therefore, the chlorine gas protocol is a highly efficient method of sterilizing wheat seeds and was selected to sterilize the seeds needed for experiments conducted in the present study. Cold and biological stratification
[00233] [00233] For cold stratification, seeds with sterilized surfaces were kept on moistened filter paper in a cold room at 4 º C for 48 hours [Mukhopadhyay et al., 2004; Wu et al., 2008]. After 2 days, the cold stratified seeds were brought to room temperature where they were quickly washed in sterile distilled water and placed on potato dextrose agar (PDA) plates. For biological stratification, sterilized seeds were incubated in the presence of SMCD 2206. Fungal endophyte was cultured in PDA at room temperature in the dark for at least three days an-
[00234] [00234] Emergence of the first radicles was carefully monitored. Germination percentage was calculated by estimating the number of germinated seeds of 10 wheat seeds in each PDA plate. A germination rate of 50% was assumed as the germination energy. The germination efficiency in different treatments was calculated by the following equation:
[00235] [00235] Efficacy = % germination in a treatment - % germination in the control [Eqn. 1]
[00236] [00236] Germination rate was observed in all treated samples and replicates. For Day 2 and Day 3 samples, germ rate
[00237] [00237] After observing the germination rate, PDA plates were immediately transferred to a sterile biosafety hood for isolation of coleorrhiza. Wheat seeds were carefully dissected under a compound microscope and layers of coleorhiza were cleaved using a sterile needle and scalpel. Isolated coleorrheses were stored in a sterilized RNase-free microcentrifuge tube. Seeds from all biological replicas of a treatment were combined and approximately 20 to 30 coleorhizas were isolated to obtain a better amount of plant material for RNA extraction. RNA extraction and cDNA synthesis
[00238] [00238] To avoid any degradation in the plant material, the RNA extraction was performed immediately after the isolation of cholerrhea each day. Approximately 20 mg of cholesterol samples were collected for RNA extraction. Total RNA was extracted
[00239] [00239] Expression of functional gibberellin and absci-acid genes.
[00240] Actin amplicons and various GA and ABA genes were purified using BioBasic PCR Purification kit (Bio Basic Inc.). For each treatment, purified amplicons were sent to the se-
[00241] [00241] An analysis of variance of percentage germination and gene expression data was performed using IBM SPSS Statistics version 19 software. Differences between control and stratification treatments were examined with Duncan's post-hoc test. Results and discussion Percentage and germination efficiency
[00242] [00242] Both cold stratification and biological stratification treatments significantly increased the germination rate with all three treatments showing a higher germination percentage than the control (Figure 46A; Table 8). Direct endophyte showed higher germination percentage after each day and an increase of 60% from Day 1 to Day 3. During the entire germination period (3 days) it showed significantly ( P < 0.05) greater capacity germination than the other three treatments. Only the biological stratification treatments produced more than 50% germination after day 2. Interestingly, indirect treatments with endophytes did not show germination after Day 1, but produced a remarkable germination of 50% after Day 2. Treatment with Cold stratification showed no significant difference from the control after Day 1, and then steadily increased, showing significant difference after Day 2 and Day 3. Pattern of increase in germination is also reflected in R values two . Whereas the control showed an R 2 value of 0.40, cold stratification and direct endophyte treatment showed 0.60 and 0.75, respectively. On the other hand, due to its 50% increase from the
[00243] [00243] Stratification plays an important ecological role in the release of primary dormancy and enhancement of seed germination [Bewley and Black 1982; Probert et al., 1989]. Relief of seed dormancy and improved germination through cold stratification has been achieved in many species, including grasses [Schutz and Rave 1999], blackberry [Koyuncu 2005], pine [Carpita et al., 1983], tobacco [Wu et al., 2008], rice [Mukhopadhyay et al. 2004], and apple [Bogatek and Lewak 1988]. Germination was also increased by cold stratification in 33 species of annual weeds, and stratification was even proposed to be able to nullify differences in seed germination capacity between populations [Milberg and Andersson 1998]. However, little information is available on the impact of cold stratification on wheat seed germination. This study concluded that the effect of cold stratification requires an initial period and therefore seed germination was not significantly different from the control on Day 1. However, it demonstrated considerable impact on Day 2 germination and germination percentage, increased as much as 20% greater than the control. The cold stratification period in this study was selected from previous reports that showed a 48-hour period is effective for cold stratification in tobacco stratification [Wu et al., 2008 ] rice and [Mukhopadhyay et al. 2004]. Previous studies have shown that the effects of cold stratification is proportional to its length time [Baskin et al. 1992; Cavieres and Arroyo, 2000]. The results support this and further extend the notion of predicting that a slightly longer period of stratification (~4 days) may be required for the wheat to reach maximum germination capacity.
[00244] [00244] Several reports show increased seed germination through the application of fungal endophytes [Vujanovic 2007b; Hubbard et al. 2012; Vujanovic and Vujanovic 2007]. The present study supports the concept of "mycovitalism", which is the increase in vitality through the colonization of fungi. Endophyte fungi are well known for the production of volatile compounds that affect plant phenophases [Mitchell et al., 2009; Strobel et al., 2004]. Thus, endophytes may be susceptible to affect seed germination, even when they are not in direct contact with the seeds, and this attribute is particularly useful in field conditions. Here, it was also tested how physical distance can influence seed germination under biological stratification. These results suggest that seeds in direct contact with fungal endophyte are undoubtedly more benefited than their counterparts. Direct endophyte produced the highest percentage and the efficiency of seed germination on each day of the germination period. Similar to direct endophyte contact, seeds placed 4 cm from the endophyte also germinated at a significantly higher rate than the control. However, germination percentage and effectiveness were actually affected by distance and seeds with indirect contact were between 14% and 27% less germination than those with direct contact. Furthermore, no germination activity was observed on Day 1, which was followed by a marked increase (50%) on day 2. Seed germination is an extremely complex process and its underlying mechanisms are relatively less understood [Nonogaki et al., 2010]. Thus, it is not clear how endophyte fungi facilitate the release of dormancy and start of seed germination. Considering that fungi are capable of producing a range of substances that promote plant growth, it is possible that these substances are more effective in the close vicinity. Consequently, seeds with direct endophytes have significantly higher germination rate than other treatments. On the contrary, seeds with indirect endophytes showed high germination efficiency after 48 hours, this period may have allowed sufficient accumulation of growth-promoting substances. There is a difference in germination percentage (6.6%) between control treatments and indirect endophytes on day 1, however, it is not substantial. Expression level of gibberellin and abscisic acid genes in coleorriza
[00245] [00245] The GA3-oxidase and 14-3-3 genes were selected as the GA biosynthetic gene and the negative regulator of the GA biosynthesis pathway, respectively [Ji et al, 2011 ; Zhang et al., 2007]. The NCED gene is well known for its role in the ABA biosynthesis pathway while the ABA 8'-hydroxylase gene is involved in the ABA catabolic pathway [Ji et al., 2011] . Real-time quantitative PCR analysis indicated that the differential values (Figure 47) and expression ratio (Figure 48) of distinct functional genes varied significantly (P < 0.05) between treatments. Except for gene 14-3-3 on Day 3, detectable expression was observed for all four genes on each day. On day 1, all genes were down-regulated compared to the control.
[00246] [00246] The gene expression ratio of GA and ABA biosynthesis, TaGA3ox2:TaNCED2, shows no appreciable difference between treatments on Day 1, but has steadily increased since then (Figure 48). Indirect endophyte showed the highest value on day 2, which is about 5-10 times higher than the other treatments; however, all three stratification treatments showed similar values on Day 3. On the other hand, for the relationship between GA biosynthesis and catabolic genes (TaGA3ox2: 14-3-3), direct endophyte showed higher value on day 1 followed by indirect endophyte, cold stratification, and control, which is quite similar to its germination percentage. The proportion of GA and ABA catabolic biosynthesis genes, TaGA3ox2: TaABA1, showed similar patterns for all treatments on Day 1, however, indirect endophyte was considerably higher than others on Day 2. On Day 3, cold stratification and indirect endophyte showed similar expression level and control was insignificant. The proportion between ABA and (TaNCED2: TaABA1) catabolic biosynthesis genes did not vary between treatments during the germination period, although cold stratification showed slightly higher expression level on Day 1.
[00247] [00247] The genes encoding GA and ABA catabolism biosynthesis enzymes show differential expression patterns depending on the accumulation of transcription [Hedden and Phillips, 2000] . Expression patterns of GA3ox1 genes have been studied in a large number of plant species including Arabidopsis [Phillips et al., 1995], rice [Oikawa et al., 2004], and wheat [Zhang et al., 2007]. Whereas other GA biosynthesis genes such as GA-20ox are associated
[00248] [00248] The expression patterns of ABA pathway genes have been studied in a wide range of cereals and legumes including rice [Oliver et al., 2007], wheat [Ji et al., 2011; Nakamura et al., 2010], beans [Qin and Zeevart, 1999]. The results of this study show that, except for control and cold stratification on day 1, TaNCED2 gene expression did not vary between treatments. Abscisic acid plays a key role in adaptation pathways to stress [ Nakamura et al., 2010 ] . Since the cold stratification seeds were kept at 4 º C for 48 hours before incubation at room temperature, the abscisic acid content may have been higher. On the other hand, the high expression of TaNCED2 in the control may have resulted in a greater synthesis of ABA and, therefore, in a slower germination rate. Recent reports suggest that ABA catabolism occurs mainly in choleorrhyza [Millar et al., 2006; Okamoto et al., 2006]. Furthermore, Barrero et al. [2009] reported increased regulation and increased expression of ABA8'OH-1 in barley coleorrhyza. Similar to these reports, here high pattern of TaABA8'OH1 gene expression was found in wheat coleorrhyza. The proportion of genes from GA and ABA biosynthesis was closely linked to germination percentage. Although, TaGA3ox2:TaNCED2 did not change remarkably on day 1, it was higher in indirect endophyte on day 2 due to its significant increase. On the other hand, all three stratification treatments showed considerable up-regulation of Ta-GA3ox2: TaNCED2 on Day 3, which may have reflected in their germination.
[00249] [00249] The underlying mechanisms of biological stratification are still relatively unknown, but they could reveal how plant-fungus interactions occur in the early stages of germination. The role of endophytic fungi as biopotentiators is widely recognized [Arnold et al., 2001; Hubbard et al. 2011; Saikkonen et al., 1998; Khan et al. 2012]. In this study, it was demonstrated that endophyte fungi can significantly stimulate seed germination, and this mycovitality is proportional to the physical distance between the seed and the fungus endophyte. In addition, the fungal endophyte-mediated biological stratification effect is considerably higher than cold pretreatment. Previous studies have shown that the start of germination is proportional to the time of cold stratification [Cavieres and Arroyo, 2000b], considering this, the future study may extend the period of cold stratification (> 48 hours) to increase the capacity of seed germination in wheat. Although cold stratification increased the level of transcripts.
[00250] [00250] No study had compared germination patterns under cold and biological stratification, and elucidated biosynthesis and catabolic gene expression of GA and ABA in wheat coleorrhiza. Coleorriza has recently shown itself to be a highly active component of germinating seeds [Barrero et al., 2009]. In accordance with this Example, elevated expression of several functional genes in cholerhya from germinating wheat seeds was also demonstrated. Seed germination can be substantially increased through the application of fungal endophytes: 1) through indirect mycovitality or without endophyte-seed contact at the distance tested (eg the 4 cm distance was used in this Example) and 2) through - via direct mycovitality or once the endophyte has reached the seed. Example 13 Effects of endophytic stratification on hormonal regulators (RSG and KAO) and MYBs resistance genes
[00251] [00251] Stratification is the exposure of seeds to cold and humid conditions in order to break dormancy, or improve seed germination. As stratification is currently limited to the role of abiotic factors, this study aims to make the definition more comprehensive by recognizing the role of biotic factors using mycovitality, or a fungus-seed symbiosis as a model. This recognizes the existence of both cold and biological stratification. The germination of wheat seeds subjected to cold stratification at 4 º C was compared with that of inoculated wheat seeds at room temperature. The seeds were inoculated with an endo-
[00252] [00252] This study is a continuation of Example 12. The same material (wheat and SMCD 2206) and in vitro methods, as well as the extracted RNA samples were used to evaluate phytohormone and expression of regulatory genes RSG and KAO and MYB resistance by qRT - PCR.
[00253] [00253] Before starting RNA extraction, tubes containing coleorrhaza tissues were stored in liquid nitrogen immediately after Coleorrhaza tissues were isolated to preserve the cells.
[00254] Real-time quantitative PCR (qRT-PCR) was performed on a MiniOpticon™ Real-Time PCR Detection System (Bio-Rad Laboratories) with iQ TM SYBR ® Green Supermix Kit (Bio-Rad Laboratories). In order to normalize the QRT-PCR data, actin gene (131 bp long fragment) was selected as a reference gene and served as an internal control to avoid polarization of fluctuating gene expression under low concentration of cDNA [Zhang et al. 2007; Nicot 2005]. KAO and RSG gene primers according to Zhang et al. [2007] were tested in this experiment, while original primers were designed for MYB1 and MYB2 based on publicly available Triticum aestivum sequences (http://compbio.dfci.harvard.edu/cgi-bin/tgi/geneprod_search. pl) Computational Biology and Functional Genomics Laboratory (Harvard University). The newly designed MBY primers (Table 9):
[00255] [00255] Myb2 mRNA transcription factor (158bp), which comprises the sequences as shown in SEQ ID NO: 16 and SEQ ID NO: 17 and the Myb1 mRNA transcription factor (152bp), which comprises the sequences as shown in SEQ ID NO: 18 and SEQ ID NO: 19 (Table 9).
[00256] [00256] 100 ng/l of cDNA samples were further diluted to ng/l and 2 l of cDNA was used for each 25 l reaction.
[00257] [00257] Nitric oxide (NO) is a highly reactive signal molecule common to fungal, plant and animal systems. NO is also known as a signaling molecule involved in eukaryotic cell hormone signaling [Guo et al. 2003] and plant response to abiotic and biotic stresses [Hayat et al. 2010]. Although there is no evidence of any accumulation of NO, increased activation of SOD and proline contributing to the delay of accumulation of O2- and H2O 2 in wheat leaves under salt stress, there is almost no information for fungal endophytes and there is interaction with seed germination (mycovitalism). Here, the occurrence of NO in the early germination stages of AC Avonlea wheat seeds was investigated for three days - endophyte SMCD 2206 in PDA, focusing on radicle response to diffusible fungal molecules. NO was visualized in radicle (early root organ) in germinant culture by fluorescence microscopy using the diacetate-specific 4,5-diaminofluorescence probe; evaluation was performed after five minutes of exposure to fungal exudate, as sufficient to induce significant accumulation of NO [Calcagno et al. 2012]. Thus, SMCD 2206 exudate induced significant NO production in wheat root tissues; Without intending to be bound by theory, it is possible that this production is regulated by a molecular dialogue taking place in the symbiosis of wheat. Material and methods
[00258] [00258] The accumulation of NO in the radicle tissues was analyzed in germinating AC Avonlea wheat seed (in vitro approach presented in Example 12) using the specific DAF-2DA probe for NO permeable in the cell according to Calcagno et al. . [2012] which is converted to its fluorescent triazole derivative DAF-2T after reaction with NO. The formation of DAF-2T was visualized by fluorescence microscopy (Cari Zeiss Axioscop 2). AC Avonlea germinant was evaluated at 5 min after treatment with SMCD 2206 fungus exudate after the procedure proposed by Nakatsubo et al. [1998]
[00259] [00259] The specificity of this response to endophytic SMCD 2206 was confirmed by the lack of response in non-inoculated radical cells. Analyzes were repeated with three independent biological replicates. Results and discussion
[00260] [00260] Seed treatment with fungus exudate can mimic, to some extent, the approach of endophytic hyphae during the pre-symbiotic phase of the interaction, as suggested for AM mycorrhiza in co-culture with Arabidopsis roots [Calcagno et al. 2010]. Fungal exudate can therefore be used with confidence to test whether diffusible fungal signals cause accumulation of NO in host wheat tissues (Figure 51) during early germination events that improve mycovitality.
[00261] [00261] Cellular evidence therefore suggests that the accumulation of NO is a new component in the signaling pathway that leads to mycosymbiosis related to mycovitalism of wheat seeds (Figure 51). This finding has both theoretical and practical value in trying to improve prenatal plant care using endophytic symbionts. Example 15 Study of the effects of endophytes on phytoremediation and phytorecovery
[00262] [00262] Phytoremediation is a promising environmental technique. It has been demonstrated in terms of costs for the recovery of hydrocarbon/petroleum, salt, heavy metal and radioisotope contaminated soils. In this study, the effects of coniferous (Picea or Pinus) and deciduous (Salix or Populus) trees, shrubs (Caragana or krascheninnikovia),
[00263] Although the present invention has been described with reference to what are presently considered to be the examples, it is to be understood that this invention is not limited to the disclosed examples. Rather, the description is intended to cover various modifications and equivalent arrangements included within the spirit and scope of the appended claims.
[00264] [00264] All publications, patents and patent applications are hereby incorporated by reference in their entirety to the same extent as if each individual publication, patent or patent application were specifically and individually indicated to be incorporated by reference in their entirety.
[00265] [00265] Within the lines, the mean is not statistically significant at p ≥ 0.05.
[00266] [00266] Myb2 mRNA transcription factor (158bp)
[00267] [00267] TaMyb2 1Facatcaagcgcggcaacttca (SEQ ID NO:16)
[00268] [00268] TaMyb2 1Rgagccgcttcttgaggtgggtgt(SEQ ID NO:17)
[00269] [00269] Myb1 mRNA transcription factor (152bp)
[00270] [00270] TaMyb1 1Fccagggaggacggacaacga (SEQ ID NO:18)
[00271] [00271] TaMyb1 1Rctctgcgccgtctcgaagg(SEQ ID NO:19) REFERENCES
[00272] [00272] Abdellatif et al. 2009. Mycological Research, 113:782-791.
[00273] [00273] Abdellatif et al. 2010. Can JPlant Pathol, 32: 468-480.
[00274] [00274] Adriaensen et al. 2006. Mycorrhiza, 16: 553–558.
[00275] [00275] Agius et al. 2006. PNAS, 103: 11796–11801.
[00276] [00276] Ali et al. 1994. Annals of Applied Biology, 125: 367–375.
[00277] [00277] Allen 1958. Forest Chron, 34: 266-298.
[00278] [00278] Armas et al. 2004. Ecology, 85: 2682-2686.
[00279] [00279] Arnold et al. 2001. Mycological Research, 105: 1502-1507.
[00280] [00280] Bacon and White 2000. In: Bacon CW and White JFJ (Eds), Microbial endophytes. Marcel Dekker Inc; New York, NY, USA. 237–
[00281] [00281] Bae et al. 2009. J Exp Bot 60: 3279–3295.
[00282] [00282] Baird et al. 2010. Mycorrhiza. 20: 541-549.
[00283] [00283] Barrero et al. 2009. Plant Physiology, 150: 1006-1021.
[00284] [00284] Baskin et al. 1992. International Journal of Plant Sciences, 153: 239-243.
[00285] [00285] Baskin and Baskin 2004. Sci. Res., 14: 1-16.
[00286] [00286] Bewley and Black 1982. Physiology and Biochemistry of Seeds. 2. Viability, Dormancy, and Environmental Control. Springer-Verlag, Berlin.
[00287] [00287] Bloom and Richard 2002. ASAE Paper No. 027010. ASAE, St. Joseph, MI.
[00288] [00288] Bogatek and Lewak 1988. Plantarum Physiology, 73: 406-
[00289] [00289] Boyko and Kovalchuk 2008. Environmental and Molecular Mutagenesis, 49: 61–72.
[00290] [00290] Bradford 2002. In: J. Kigel J, Galili G (eds), Seed Develop and Germin. Marcel Dekker Inc, New York, pp. 351-396.
[00291] [00291] Calcagno et al. 2012. Mycorrhiza, 22:259-69.
[00292] [00292] Cao and Moss. 1989. Crop Sci, 29: 1018-1021.
[00293] [00293] Carpita et al. 1983. Plantarum Physiology 59: 601-606.
[00294] [00294] Cavieres and Arroyo, 2000. Plant Ecology 149: 1–8.
[00295] [00295] Cavieres and Arroyo, 2000b. Gayana Botanica 64: 40-45.
[00296] [00296] Charlton et.al. 2008. Metabolomics, 4: 312–327.
[00297] [00297] Chau et al. 2012. Fungal Biology, 116:1212-1218.
[00298] [00298] Chipanshi et al. 2006. Clim Res, 30: 175–187.
[00299] [00299] Choi and Sano, 2007. Molecular Genetics and Genomics, 277: 589–600.
[00300] [00300] Davitt et al. 2010. New Phytol, 188: 824–834.
[00301] [00301] by Bary 1866. Vol. II. Hofmeister's Handbook of Physiological Botany. Leipzig, Germany.
[00302] [00302] Desfeux et al., 2000. Plant Physiology, 123: 895-904.
[00303] [00303] Dong-dong et al. 2009. J Zhejiang Univ-Sci B, 9:964-968.
[00304] [00304] Farquhar and Richards 1984. Australian Journal Plant Physiology 11: 539–552.
[00305] [00305] Farquhar et al. 1989 In: Jones HG, Flowers TJ and Jones MB (Eds) Plants under stress. Cambridge University Press, Cambridge, pp 47–69.
[00306] [00306] Farquhar et al. 1989b. Annual Review of Plant Physiology and Plant Molecular Biology. 40: 503-537.
[00307] [00307] Finnegan et al. 1998. Plant Molecular Biology 95: 5824–
[00308] [00308] Freeman 1904. Philosophical Transactions of the Royal Society London (Biology) 196: 1-27.
[00309] [00309] Friend et al. 1962. Can J Bot, 40: 1299-1311.
[00310] [00310] Gan et al. 2004. Can. J Plant Sci, 84: 697-704.
[00311] [00311] Germida et al. 2010. Field-scale assessment of phytoremediation at a former oil tank battery in Bruderheim, Alberta. World Congress of Soil Science, Soil Solutions for a Changing World, 1-6 August
[00312] [00312] Gizinger 2002. Experimental Hematology, 30: 503-512.
[00313] [00313] Gornall et al. 2010. Phil. Trans. R. Soc. B, 365, 2973-2989.
[00314] [00314] Grant et al. 2009. Tree Physiology, 29: 1–17.
[00315] [00315] Gummerson 1986. J Exp Bot, 37: 729-741.
[00316] [00316] Gundel et al. 2010. Evol Appl, 3: 538–546.
[00317] [00317] Guo et al. 2003. Science, 302: 100-103.
[00318] [00318] Hayat et al. 2010. Nitric Oxide in Plant Physiology, Issue 58, Willey-VCH Verlag, Germany.
[00319] [00319] Hedden and Phillips, 2000. Trends in Plant Science, 5: 523-
[00320] [00320] Hubbard et al. 2011. In: Wheat: Genetics, Crops and Food Production. New Science Publishers Hauppauge, NY, USA. pp. 333-
[00321] [00321] Hubbard et al. 2012. Botany, 90(2): 137-149.
[00322] [00322] Jame et al. 1998. Agric Forest Meteorol 92: 241-249.
[00323] [00323] Ji et al., 2011. Plant Physiology, 156: 647-662.
[00324] [00324] Johannes et al. 2009. Plos Genetics 5: e1000530.
[00325] [00325] Johannes et al. 2011. Genetics, 188: 215–227.
[00326] [00326] Johnson et al. 1990. Crop Science, 30: 338–343.
[00327] [00327] Jost et al. 2001. Nucleic Acids Research, 29: 4452–4461.
[00328] [00328] Jumpponen and Trappe 1998. New Phytologist, 140: 295-
[00329] [00329] Jurado et al., 2010. Food Microbiology, 27: 50-57.
[00330] [00330] Kane 2011. Environmental and Experimental Botany, 71: 337-344.
[00331] [00331] Kang et al. 2008. International Journal of Sustainable Development and World Ecology, 15: 440–447.
[00332] [00332] Karavata & Manetas 1999. Photosynthetica, 36: 41-49.
[00333] [00333] Khan et al. 2010. Pakistan Journal of Botany, 42: 259–267.
[00334] [00334] Khan et al. 2012. BMC Microbiol, 12; 12:3.
[00335] [00335] Kiffer and Morelet 2000. Science Publisher Inc, Enfield, NH, Plymouth.
[00336] [00336] Köchy and Tielbörger 2007. Basic Appl Ecol 8: 171-182.
[00337] [00337] Koyuncu 2005. Acta Biologica Cracoviensia Series Botanica, 47: 23-26.
[00338] [00338] Labeda et al 2012. Antonie van Leeuwenhoek, 101:73–104.
[00339] [00339] Lang-Mladek et al. 2010. Molecular Plant, 3: 594–602.
[00340] [00340] Larran et al. 2002. World Journal of Microbial Biotechnology, 18: 683-686.
[00341] [00341] Leone et al. 1994. Physiol Plantarum, 92: 21-30.
[00342] [00342] Li et al. 2008. Ecological Research, 23: 927–930.
[00343] [00343] Li et al. 2011. Agronomy Journal, 103: 1619–1628.
[00344] [00344] Lu et al. 2007. Plant Biology, 49: 1599–1607.
[00345] [00345] Lucht et al. 2002. Nature Genetics, 30: 311-314.
[00346] [00346] Madsood et al. 2005. Engineering Applications of Artificial Intelligence, 18: 115–125.
[00347] [00347] Margulis, 1991. In Symbiosis as a Source of Evolutionary Innovation, L. Margulis and R. Fester, ed. The MIT Press: Cambridge. pp. 1–14.
[00348] [00348] Marquez et al. 2007. Science, 315: 513-515.
[00349] [00349] McCormick MC, Siegel (eds.) 1999. Prenatal Care: Effectivity and implementation. Cambridge University Press UK.
[00350] [00350] McDonald 2009. Handbook of biological statistics. 2nd ed. Sparky House Publishing, Baltimore, Maryland.
[00351] [00351] McMaster 2009. In: Carver BF (ed), Wheat, science and trade, Wiley-Blackwell, Iowa, USA, pp. 31-55.
[00352] Milberg and Andersson 1998. Plant Ecology, 134: 225-234.
[00353] [00353] Millar et al., 2006. Plant Journal, 45: 942–954.
[00354] [00354] Miransari et al. 2011. Applied Microbiology and Biotechnology, 92: 875–885.
[00355] [00355] Mitchell et al., 2009. Microbiology-SGM, 156: 270-277.
[00356] [00356] Mühlmann and Peintner 2000. Mycorrhiza, 18: 171–180.
[00357] [00357] Mukhopadhyay et al., 2004. PNAS, 101: 6309-6314.
[00358] [00358] Nakatsubo et al. 1998. FEBS Lett, 427:263–266.
[00359] [00359] Nakamura et al., 2010. Euphytica, 171: 111-120.
[00360] [00360] Nelson, 2004. Annu Rev Phytopathol, 42: 271–309.
[00361] [00361] Nicot 2005. Journal of Experimental Botany, 56: 2907-2914.
[00362] [00362] Nonogaki et al., 2010. Plant Science, 179: 574-581.
[00363] [00363] Oikawa et al., 2004. Plant Molecular Biology, 55: 687-700.
[00364] [00364] Okamoto et al., 2006. Plant Physiology, 141:97–107.
[00365] [00365] Oliver et al., 2007. Plant and Cell Physiology, 48: 1319-
[00366] [00366] Penterman et al. 2007. PNAS, 104: 6752-6757.
[00367] [00367] Phillips et al., 1995. Plant Physiology, 108: 1049-1057.
[00368] [00368] Probert et al., 1989. Journal of Experimental Botany, 40: 293-301.
[00369] [00369] Qin and Zeevart, 1999. PNAS, 96: 15354-15361.
[00370] [00370] Reynolds et al. 2007 Journal of Experimental Botany, 58: 177–186.
[00371] [00371] Richards et al. 2002. Crop Science, 42: 111–121.
[00372] [00372] Ries et al. 2000. Nature, 406: 98-101.
[00373] [00373] Rivero et al. 2011. International Conference on Arabidopsis Research. June 22-25, Madison USA.
[00374] [00374] Ruan et al. 2002. Seed Sci Technol, 30: 61-67.
[00375] [00375] Ryan et al. 2008. FEMS Microbiol Lett, 278: 1–9.
[00376] [00376] Saikkonen et al., 1998. Annual Review of Ecology and Systems, 29: 319–343.
[00377] [00377] Saze 2008. Seminars in Cell and Developmental Biology, 19: 527–536.
[00378] [00378] Schrey and Tarkka 2008. Antonie van Leeuwenhoek, 94:11-
[00379] [00379] Schutz and Rave 1999. Ecology, 144: 215-230.
[00380] [00380] Semenov and Shewry 2011. Scientific Reports, 1: 66–71.
[00381] [00381] Sinclair et al. 1984. BioScience, 34: 36–40.
[00382] [00382] Singh et al. 2011. Plant Signal Behav, 6: 175–191.
[00383] [00383] Smith and Read 2008. Mycorrhizal symbiosis, Third Edition. Elsevier Ltd. Mycorrhizas in acholorophyllous plants (mycoheterotrophs). Chapter 13: 458-507.
[00384] [00384] Solaiman et al. 2010. Australian Journal of Soil Research, 48: 546–554.
[00385] [00385] Soleimani et al. 2010. Chemosphere, 81: 1084–1090.
[00386] [00386] Stone et al., 2000. In: Bacon, C.W. and White, J.F. eds., Microbial Endophytes, Marcel Dekker: New York Chap. 1: 3-29.
[00387] [00387] Strobel et al., 2004. Journal of Natural Products, 67: 257-
[00388] [00388] Sun et al. 2010. Journal of Plant Physiolog, 167: 1009–
[00389] [00389] Tan and Zou, 2001. Nat Prod Rep, 18: 448-45.
[00390] [00390] Tokala et al. 2002. Appl Environ Microbiol, 68:2161-2171.
[00391] [00391] Vaughn et al. 2007. PloS Biology, 5: 1617–1629.
[00392] [00392] Verhoeven et al. 2010. New Phytologis, 185: 1108–1118.
[00393] [00393] Vujanovic et al. 2000. Annals of Botany, 86: 79–86.
[00394] [00394] Vujanovic and Brisson 2002. Mycological Progress. 1: 147–
[00395] [00395] Vujanovic and Vujanovic 2006. Floriculture, Ornamental and Plant Biotech, 63: 563-569.
[00396] [00396] Vujanovic and Vujanovic 2007. Symbiosis, 44: 93-99.
[00397] [00397] Vujanovic 2007b. Can J Plant Pathol, 29: 451–451.
[00398] [00398] Vujanovic 2008. 19th International Conference on Arabidopsis. Research Proceedings- ICAR13, July 23–27, Montreal, QC,
[00399] [00399] Waller et al. 2005. PNAS, 102: 13386–13391.
[00400] [00400] Wallin 1927. Symbionticism and the Origin of Species. London: Baillière, Tindall and Cox.
[00401] [00401] Wang et al. 2011. Journal of Experimental Botany, 62: 1951–1960.
[00402] [00402] Whalley et al. 2006. Plant and Soil, 280: 279–290.
[00403] [00403] White and Torres 2010. Physiol. Plant, 138: 440–446.
[00404] [00404] Wu et al. 2008. Plant Physiology, 148: 1953-1963.
[00405] [00405] Wu and Sardo 2010. Lichtfouse E. (Ed.), Sociology, Organic Farming, Climate Change and Soil Science. Sustainable Agriculture Reviews. 3: DOI 10.1007/978-90-481-3333-8_3.
[00406] [00406] Yamaguchi et al. 1998. Plant Cell, 10: 2115–2126
[00407] [00407] Yang et al., 2002. Planta, 215: 645–652.
[00408] [00408] Zadoks et al. 1974. Weed Research, 14:415-421.
[00409] [00409] Zhang et al., 2007. BMC Genet, 2007, 8:40.
[00410] [00410] Zhang et al. 2010. Journal of Cereal Science, 52: 263–269.
[00411] [00411] Zhang et al. 2011. African Journal of Microbiology Research, 5:5540–5547.
[00412] [00412] Zhao et al. 2007. Journal of Plant Nutrition, 30: 947–963.
[00413] [00413] Zhong et al. 2009. African Journal of Biotechnology, 8: 6201–6207.
[00414] [00414] Zhu et al. 2007. Current Biology, 17: 54–59.
[00415] [00415] Foresight. The future of food and farming: challenges and choices for global sustainability. Final Project Report. London: The Government Office for Science, UK, 2011.
[00416] [00416] IPCC Climate Change 2007. In: Solomon S, Qin D, Manning M, Chen Z, Marquis M, Averyt KB, Tignor M and Miller HL (Eds). Cambridge University Press, Cambridge, UK.
[00417] [00417] Saskatchewan Ministry of Agriculture 2008. Varieties of
[00418] [00418] The original code deposits SMCD2204, SMCD2204F, SMCD2206, SMCD2208, SMCD2210 and SMCD2215 were deposited with the International Depositary Authority of Canada (IDAC) on 20.03.2012,
20.03.2012, 08.11.2011, 08.11.2011, 08.11.2011 and 08.11.2011. Deposit receipts were issued by the Authority on 03.21.2012,
21.03.2012, 09.11.2011, 09.11.2011, 09.11.2011 and 09.11.2011. Viability statements for each deposit were also issued by the International Depositary Authority of Canada, with all deposits deemed viable.

权利要求:
Claims (21)
[1]
1. Isolated endophyte, characterized in that it is selected from the group consisting of: a Streptomyces sp strain or culture thereof, which is deposited under IDAC 081111-06 or which comprises the 16S rDNA sequence as shown in SEQ ID NO: 6; a Paraconyothirium sp. or culture thereof, which is deposited as IDAC 081111-03 or which comprises the sequence ITS rDNA as shown in SEQ ID NO:5; a Pseudeurotium sp. or culture thereof, which is deposited under IDAC 081111-02 or which comprises the sequence ITS rDNA as shown in SEQ ID NO:4; a Penicillium sp. or culture thereof, which is deposited under IDAC 081111-01 or which comprises the sequence ITS rDNA as shown in SEQ ID NO:3; a Cladosporium sp. or culture thereof, which is deposited under IDAC 200312-06 or which comprises the sequence ITS rDNA as shown in SEQ ID NO: 1, a Cladosporium sp. or culture thereof, which is deposited under IDAC 200312-05 or which comprises the sequence ITS rDNA as shown in SEQ ID NO:2.
[2]
2. Composition, characterized in that it comprises at least one isolated endophyte or culture, as defined in claim 1, and a vehicle.
[3]
3. Seed, characterized by the fact that it comprises at least one endophyte or culture, as defined in claim 1.
[4]
4. Seed, according to claim 3, characterized in that the seed is a cereal, legume, flax or canola plant.
[5]
5. Method for improving the vitality of seeds, the health and/or yield of a plant, characterized in that it comprises inoculating a seed with at least one endophyte or crop, as defined in claim 1, and cultivating the seed into a first-generation plant.
[6]
6. Method according to claim 5, characterized in that it is to increase seed germination, to decrease the time to reach germination energy, to reduce the time required for hydrothermal germination, to increase seed germination vigor, to increase seedling fresh weight, to improve nodulation characteristics of Rhizobium, to increase seedling production, to reduce the stress effects on the seed or the cultivated plant, to reduce the effects dry stress, heat and/or biotic stress on the seed or cultivated plant, to reduce the effects of Fusarium infection on the seed or cultivated plant, to improve stratification, break dormancy and/or reduce the effects of stress by modulating the expression of hormonal ent -kaurenoic (KAO) genes, the repression of shoot growth genes (RSG), abscisic acid (ABA), gibberellic acid (GA), 14- 3-3 and nitric oxide molecules co (NO), and/or stress resistance of superoxide dismutase (SOD), manganese SOD (MnSOD), proline (Pro) and MYB genes.
[7]
7. Method according to claim 5, characterized in that the plant is a cereal, legume, flax, or canola plant.
[8]
8. Method according to claim 5, characterized in that the seed is coated with the endophyte, cultivated with the endophyte or planted close to the endophyte.
[9]
9. Method according to claim 8, characterized in that the seed planted close to the endophyte is about 4 cm away from the endophyte.
[10]
10. Method of improving plant health and/or yield, characterized in that it comprises treating a plant propagation material with the endophyte or crop, as defined in claim 1, and cultivating the plant propagation material in a first generation plant.
[11]
11. Method according to claim 10, characterized in that the plant propagation material is a seed, cut or a bulb.
[12]
12. Method according to claim 10, characterized in that it is to reduce the effects of stress.
[13]
13. Method according to claim 10, characterized in that it is to reduce the effects of stress, in which the stress is due to heat, dry stress or biotic stress.
[14]
14. Method for improving the health of a plant and/or the yield of a plant, characterized in that it comprises treating a plant with at least one endophyte or crop, as defined in claim 1, and allowing the plant to grow up.
[15]
15. Method according to claim 14, characterized in that it is to reduce the effects of stress.
[16]
16. Method according to claim 14, characterized in that it is to reduce the effects of stress, in which the stress is due to heat, dry stress or biotic stress.
[17]
17. Method according to claim 14, characterized in that the treatment of the plant comprises foliar or soil application.
[18]
18. Method of phytoremediation or phytorecovery from a contaminated site, characterized in that it comprises treating a plant propagation material or a plant with at least one endophyte or culture, as defined in claim 1, and cultivating the material propagating the plant into a first-generation plant or allowing the plant to grow; thus, remedying or restoring the site.
[19]
The method of claim 18, characterized in
the fact that the site is contaminated with an organic chemical, a salt, or a metal.
[20]
20. Method according to claim 18, characterized in that the site is contaminated with an organic chemical and the organic chemical is either hydrocarbon or petroleum.
[21]
21. Method according to claim 18, characterized in that the site is contaminated with a metal and the metal is lead or cadmium and/or a radioisotope.

类似技术:

---

公开号 | 公开日 | 专利标题

---

US11064673B2|2021-07-20|Endophytic microbial symbionts in plant prenatal care

---

Orlikowska et al.2017|Bacteria in the plant tissue culture environment

---

Marschner et al.2005|Interactions between plant species and mycorrhizal colonization on the bacterial community composition in the rhizosphere

---

Qi et al.2013|Study of the siderophore‐producing Trichoderma asperellum Q1 on cucumber growth promotion under salt stress

---

Mishra et al.2011|Alleviation of cold stress in inoculated wheat | seedlings with psychrotolerant Pseudomonads from NW Himalayas

---

Kloepper et al.2004|Application for rhizobacteria in transplant production and yield enhancement

---

AU2016258912A1|2017-11-30|Isolated complex endophyte compositions and methods for improved plant traits

---

Meldau et al.2012|A native plant growth promoting bacterium, Bacillus sp. B55, rescues growth performance of an ethylene-insensitive plant genotype in nature

---

Russo et al.2012|Plant beneficial microbes and their application in plant biotechnology

---

Ahirwar et al.2015|Influence on growth and fruit yield of tomato | plants by inoculation with Pseudomonas fluorescence |: Possible role of plant growth promotion

---

BR112019023237A2|2020-06-02|PLANT GROWTH PROMOTION MICROBES, COMPOSITIONS, AND USES

---

Sousa et al.2011|Reforestation of burned stands: the effect of ectomycorrhizal fungi on Pinus pinaster establishment

---

Sabet et al.2013|Using commercial compost as control measures against cucumber root-rot disease

---

Díaz et al.2013|Control of Fusarium wilt in cape gooseberry by Trichoderma koningiopsis and PGPR

---

Hubbard2012|Fungal endophytes that confer heat and drought tolerance to wheat

---

Khalil et al.2009|Effects of growing medium on the interactions between biocontrol agents and tomato root pathogens in a closed hydroponic system

---

Maulana et al.2017|Growth response of four leguminous trees to native arbuscular mycorrhizal fungi from tropical forest in Indonesia

---

CN105794455A|2016-07-27|Method for utilizing piriformospora indica and Zhongshengmycin to jointly prevent and control bacterial wilt of tobaccos

---

Cardoso et al.2011|PGPR in coniferous trees

---

Zakharchenko et al.2012|Effects of associative pseudomonads and methylobacteria on plant growth and resistance to phytopathogens and xenobiotics

---

Kongkiattikajorn et al.2007|Increased tomato yields by heat treatment for controlling Ralstonia solanacearum in soil

---

EL-Morsi et al.2015|Management of root rot and wilt diseases of date palm offshoots using certain biological control agents and its effect on growth parameters in the New Valley Governorate, Egypt

---

Meddich et al.2018|Optimizing Growth and Tolerance of Date

---

Bombeke2021|THE ROLE OF CYCLIC LIPOPEPTIDES IN BIOLOGICAL CONTROL AND NITROGEN FIXATION IN BEAN

---

Wang2015|Burkholderia phytofirmans strain PsJN effects on drought resistance, physiological responses and growth of switchgrass

同族专利:

---

公开号 | 公开日

---

US10212912B2|2019-02-26|

---

MX368358B|2019-09-30|

---

US9687001B2|2017-06-27|

---

US10104862B2|2018-10-23|

---

WO2014121366A1|2014-08-14|

---

US20190320610A1|2019-10-24|

---

RU2015137613A|2017-03-13|

---

US20160174570A1|2016-06-23|

---

IL240288A|2020-02-27|

---

AU2019264619A1|2019-12-05|

---

MX2015010142A|2016-08-11|

---

EP2954043B1|2021-07-28|

---

US20150230478A1|2015-08-20|

---

US20190082649A1|2019-03-21|

---

RU2723946C2|2020-06-18|

---

IL240288D0|2015-09-24|

---

US11064673B2|2021-07-20|

---

UA121195C2|2020-04-27|

---

EP2954043A1|2015-12-16|

---

CA2899823A1|2014-08-14|

---

EP2954043A4|2016-11-23|

---

US11076573B2|2021-08-03|

---

AU2013377774A1|2015-09-17|

---

US20150366217A1|2015-12-24|

引用文献:

---

公开号 | 申请日 | 公开日 | 申请人 | 专利标题

---

---

US2200532A|1938-08-24|1940-05-14|Kalo Inoculant Company|Bacterial inoculant for leguminous plants|

---

GB1465979A|1973-03-02|1977-03-02|Fruitgrowers Chemical Co Ltd|Coated seeds|

---

US4735015A|1983-11-25|1988-04-05|Basf Corporation|Seed protective coating|

---

US4940834A|1983-12-05|1990-07-10|Lofts, Inc.|Plants having endophytio-fungus-enhanced performance and method of producing same|

---

GB8503793D0|1985-02-14|1985-03-20|Ici Plc|Treatment of seeds|

---

US5041290A|1985-10-02|1991-08-20|Ciba-Geigy Corporation|Method of protecting useful plants from diseases caused by soil-borne and seed-borne pathogens by treating seeds with cultures of microorganisms|

---

EP0223662A1|1985-10-17|1987-05-27|Fertil France Diffusion|Process for making a stable powder of microorganisms and a bacterial inoculum|

---

US5229291A|1985-12-30|1993-07-20|Novo Industri A/S|Rhizobia transformants which symbiotically fixes nitrogen in non-legumes, a material for treating seeds of a non-legume plant, non-legume seeds, a non-legume plant and a method for producing rhizobia transconjungants|

---

US5292507A|1986-08-01|1994-03-08|Imperial Oil Limited|Method of using polysaccharides to stabilize microorganisms for inoculating plant seeds|

---

DE3851756T2|1987-05-20|1995-02-02|Crop Genetics Int|ADMINISTRATION OF ADVANTAGEOUS MICROORGANISMS IN SEEDS AND PLANTS.|

---

GB8900313D0|1989-01-06|1989-03-08|Agricultural Genetics Co|Seed coatings|

---

US5113619A|1989-01-30|1992-05-19|Leps Walter T|Method of adhering bacteria to seed and composition therefor|

---

FR2671265A1|1991-01-03|1992-07-10|Pioneer France Mais Sa|SEEDS COATED WITH MICROORGANISM DEHYDRATE PREPARATIONS AND PROCESS FOR OBTAINING THE SAME.|

---

RU2043028C1|1992-01-03|1995-09-10|Николай Петрович Покровский|Method for production stimulant of growing plants|

---

GB9300281D0|1993-01-08|1993-03-03|Zeneca Ltd|Antimicrobial-protein-producing endosymbiotic micro-organisms|

---

DE4404702A1|1994-02-15|1995-08-31|Hoechst Schering Agrevo Gmbh|Water-dispersible granules based on living organisms|

---

EP0800582B1|1994-12-30|2007-08-15|Seminis Vegetable Seeds, Inc.|Transgenic plants expressing dna constructs containing a plurality of genes to impart virus resistance|

---

US5994117A|1995-12-29|1999-11-30|The United States Of America As Represented By The Department Of Agriculture|Use of Bacillus Subtilis as an endophyte for the control of diseases caused by fungi|

---

US5916029A|1996-06-26|1999-06-29|Liphatech, Inc.|Process for producing seeds coated with a microbial composition|

---

US5919447A|1996-11-18|1999-07-06|Agraquest, Inc.|Strain of bacillus for controlling plant disease|

---

US6072107A|1997-05-27|2000-06-06|New Zealand Pastoral Agriculture Research Institute Limited|Ryegrass endophytes|

---

US6077505A|1997-06-11|2000-06-20|Wisconsin Alumni Research Foundation|Biological seed treatment to improve emergence, vigor, uniformity and yield of sweet corn|

---

CA2238289C|1998-05-20|2013-08-06|The Governors Of The University Of Alberta|Biocontrol agent and fungicide for blackleg disease|

---

US6495133B1|1998-09-30|2002-12-17|Her Majesty The Queen In Right Of Canada, As Represented By The Minister Of Agriculture & Agri-Food Canada|Gliocladium roseum strains useful for the control of fungal pathogens in plants|

---

WO2000029607A1|1998-11-17|2000-05-25|The Regents Of The University Of California|Novel enhancers of plant growth|

---

US6312940B1|1999-10-07|2001-11-06|The United States Of America As Represented By The Secretary Of Agriculture|Bacillus species for reducing fusarium head blight in cereals|

---

AU4680900A|2000-04-28|2001-11-12|Aventis Cropscience Nv|Glufosinate tolerant rice|

---

US7250553B2|2000-05-01|2007-07-31|Exelixis Plant Sciences, Inc.|System for functional gene discovery in plants|

---

JP4372975B2|2000-06-22|2009-11-25|株式会社テイエス植物研究所|Seed disease control method|

---

AU8495501A|2000-08-15|2002-02-25|Univ Arkansas|Non-toxic endophytes, plants infected therewith and methods for infecting plants|

---

US6681186B1|2000-09-08|2004-01-20|Paracel, Inc.|System and method for improving the accuracy of DNA sequencing and error probability estimation through application of a mathematical model to the analysis of electropherograms|

---

CA2420406C|2000-09-29|2014-12-09|Monsanto Technology Llc|Glyphosate tolerant wheat plant 33391 and compositions and methods for detection thereof|

---

CA2438232A1|2001-02-20|2002-08-29|Paul Stamets|Delivery systems for mycotechnologies, mycofiltration and mycoremediation|

---

GB0128134D0|2001-11-23|2002-01-16|Syngenta Participations Ag|A product for use in agriculture or horticulture|

---

US7084331B2|2002-01-15|2006-08-01|Society for Techno-Innovation of Agriculture Forestry and Fisheries|Rice containing endophytic bacteria and method of producing it|

---

JP4368559B2|2002-04-08|2009-11-18|日本曹達株式会社|Plant disease control composition and microorganism|

---

AP2004003146A0|2002-04-09|2004-09-30|Vector Tobacco Ltd|Tobacco having reduced nicotine and nitrosamines|

---

JP4313980B2|2002-04-10|2009-08-12|社団法人農林水産先端技術産業振興センター|A method for controlling diseases and pests of gramineous plants using symbiotic fungi, seeds combined with control agents and control agents|

---

US7232565B2|2002-06-21|2007-06-19|Montana State University|Use of endophytic fungi to treat plants|

---

WO2004046357A1|2002-11-15|2004-06-03|Posco|Organ preferential genes identified by t-dna insertional mutagenesis of rice|

---

US7335816B2|2003-02-28|2008-02-26|Kws Saat Ag|Glyphosate tolerant sugar beet|

---

EP1473370A3|2003-04-24|2005-03-09|BioMerieux, Inc.|Genus, group, species and/or strain specific 16S rDNA Sequences|

---

US7341868B2|2003-04-29|2008-03-11|Council Of Scientific And Industrial Research|Plasmid encoding IAA and a method thereof|

---

EP1656445A4|2003-07-07|2008-12-10|Flinders Technologies Pty Ltd|A method and agents for improving plant productivity involving endophytic actinomycetes and metabolites thereof|

---

AR047107A1|2003-08-29|2006-01-11|Inst Nac De Tecnologia Agropec|RICE PLANTS THAT HAVE A GREATER TOLERANCE TO IMIDAZOLINONA HERBICIDES|

---

US20060075522A1|2004-07-31|2006-04-06|Jaclyn Cleveland|Genes and uses for plant improvement|

---

AU2005279359B2|2004-09-02|2011-08-11|Basf Plant Science Gmbh|Disarmed agrobacterium strains, Ri-plasmids, and methods of transformation based thereon|

---

GB0422052D0|2004-10-04|2004-11-03|Dansico As|Enzymes|

---

US7485451B2|2004-11-18|2009-02-03|Regents Of The University Of California|Storage stable compositions of biological materials|

---

AP2693A|2005-05-27|2013-07-16|Monsanto Technology Llc|Soybean event MON89788 and methods for detection thereof|

---

NZ541606A|2005-08-16|2008-07-31|Grasslanz Technology Ltd|Grass endophyte enhanced attributes|

---

US20070055456A1|2005-08-31|2007-03-08|Daniel Raftery|NMR method for differentiating complex mixtures|

---

US20100154299A1|2005-09-16|2010-06-24|Takeshi Kobayashi|Seed Coated with Antagonistic Microorganism, Method for Producing the Seed, and Disease Control Method for Crop|

---

US7601346B1|2005-12-28|2009-10-13|The United States Of America, As Represented By The Secretary Of Agriculture|Choline-utilizing microbial strains for biologically controlling fusarium head blight|

---

EP1997882B1|2006-03-03|2014-07-02|Mayekawa Mfg. Co., Ltd.|Method for Controlling Plant Disease|

---

EP2001821B1|2006-03-22|2016-09-07|Adjuvants Plus Inc.|The production and use of endophytes as novel inoculants for promoting enhanced plant vigor, health, growth, yield reducing environmental stress and for reducing dependency on chemical pesticides for pest control|

---

TW200819540A|2006-07-11|2008-05-01|Genelux Corp|Methods and compositions for detection of microorganisms and cells and treatment of diseases and disorders|

---

US7928295B2|2006-08-24|2011-04-19|Bayer Bioscience N.V.|Herbicide tolerant rice plants and methods for identifying same|

---

AU2007308699B2|2006-10-24|2013-12-19|Irving Licensing Inc.|Endophyte enhanced seedlings with increased pest tolerance|

---

CN100569938C|2006-10-24|2009-12-16|林忠平|Can produce the Cladosporium endogenetic fungus of trans-resveratrol|

---

CA2562175C|2006-10-24|2013-01-08|J.D. Irving, Limited|Endophyte enhanced seedlings with increased pest tolerance and methods|

---

WO2008059054A2|2006-11-17|2008-05-22|Basf Se|Method for increasing the dry biomass of plants|

---

WO2008100892A2|2007-02-12|2008-08-21|The Samuel Roberts Noble Foundation, Inc.|Fungal endophytes of elymus canadensis|

---

US9049814B2|2007-02-23|2015-06-09|Vamtech, Llc|Coated seeds and methods of making coated seeds|

---

CN101311262B|2007-05-22|2011-06-08|上海市农药研究所|Streptomyces griseus and uses thereof|

---

EP2175730B1|2007-07-19|2011-01-19|Montana State University|Fungal isolates and their use to confer salinity and drought tolerance in plants|

---

US20090064361A1|2007-08-29|2009-03-05|Monsanto Technology Llc|Methods and Compositions for Haploid Mapping|

---

JP2009072168A|2007-09-18|2009-04-09|Univ Of Occupational & Environmental Health Japan|Method for identification of microorganism|

---

US8809059B2|2007-09-21|2014-08-19|Basf Plant Science Gmbh|Plants with increased yield|

---

CA2635401C|2007-09-21|2009-11-24|One Pass Implements Inc.|Air seeder/fertilizer apparatus having metering means and distribution manifold with selectively openable ports|

---

MX2010005352A|2007-11-15|2010-07-02|Monsanto Technology Llc|Soybean plant and seed corresponding to transgenic event mon87701 and methods for detection thereof.|

---

EP2070417A1|2007-12-14|2009-06-17|Plant Research International B.V.|Novel micro-organisms controlling plant pathogens|

---

US10362786B2|2008-04-07|2019-07-30|Bayer Intellectual Property Gmbh|Stable aqueous spore-containing formulation|

---

US20100064392A1|2008-06-10|2010-03-11|Ceres, Inc.|Nucleotide sequences and corresponding polypeptides conferring improved agricultural and/or ornamental characteristics to plants by modulating abscission|

---

CN101423810B|2008-12-11|2011-05-18|浙江大学|Streptomyces chatanoogensis and culture method|

---

US20120015806A1|2009-03-25|2012-01-19|Sitaram Prasad Paikray|Novel formulation of microbial consortium based bioinoculant for wide spread use in agriculture practices|

---

WO2010115156A2|2009-04-03|2010-10-07|Synthetic Genomics, Inc.|Endophytic fungus and uses therefor|

---

BRPI1011617A2|2009-04-07|2019-04-16|Taminco Nv|composition, and methods for enhancing the effectiveness of a plant growth regulator, and for regulating plant growth|

---

KR101066283B1|2009-04-16|2011-09-20|경북대학교 산학협력단|OCHROBACTRUM sp. KUDC????, AND PLANT DISEASE CONTROLLING AGENT AND PLANT GROWTH ACCELERANT USING THE SAME|

---

CN101570738B|2009-04-28|2011-01-12|廊坊盖雅环境科技有限公司|Agrobacterium with heterotrophic nitrification-aerobic denitrification capability and application thereof in nitrogenous effluent treatment|

---

FR2947553B1|2009-07-03|2012-02-03|Toulouse Inst Nat Polytech|CELLULOSE FATTY ESTERS, SYNTHESIS METHOD AND USES|

---

EP2456852A4|2009-07-22|2013-03-27|Univ California|Cell-based systems for production of methyl formate|

---

KR101091151B1|2009-07-28|2011-12-09|한국생명공학연구원|Novel Enterobacter sp. strains and method for stimulating the growth of plant by using them|

---

MX2012001508A|2009-08-04|2013-05-30|Evogene Ltd|Polynucleotides and polypeptides for increasing desirable plant qualities.|

---

CA2810773C|2009-09-17|2016-12-13|University Of Saskatchewan|Method for increasing plant growth using the fungus trichoderma harzianum|

---

CN101693881B|2009-10-16|2012-08-15|天津大学|High-yield strain streptomyces lydicus, breeding and fermentation thereof|

---

DK3011828T3|2010-01-07|2019-02-18|Agriculture Victoria Serv Pty|ENDOFTERS AND RELATED PROCEDURES|

---

EP3000873B1|2010-03-12|2017-08-02|Brookhaven Science Associates, LLC|A method of increasing drought tolerance in a plant|

---

WO2011117351A1|2010-03-24|2011-09-29|Georg-August-Universität Göttingen|Bio-pesticide and method for pest control|

---

US20130233501A1|2010-06-08|2013-09-12|Stellenbosch University|Modification of xylan|

---

CN102010835B|2010-07-27|2012-04-18|江苏丘陵地区镇江农业科学研究所|Streptomyces corchorusii strain NF0919, purpose and preparation method of active zymotic fluid thereof|

---

DE112010005832T5|2010-08-30|2013-06-06|Toyota Jidosha Kabushiki Kaisha|Cooling structure for a rotating electrical machine|

---

IT1405680B1|2010-09-13|2014-01-24|Inalco Spa|PROCESS FOR THE PRODUCTION OF L-FUCOSIUM.|

---

US8975489B2|2010-12-02|2015-03-10|The Samuel Roberts Noble Foundation|Grass fungal endophytes and uses thereof|

---

JP2014503517A|2010-12-10|2014-02-13|オーバーンユニバーシティー|Inoculum containing Bacillus bacteria for inducing the production of volatile organic compounds in plants|

---

CN102168022B|2010-12-28|2012-05-23|北京师范大学|Endophytic fungus Penicillium ateckii from plant Chinese Umbrellaleaf rhizome and application thereof|

---

GB201100427D0|2011-01-11|2011-02-23|Stichting Dienst Landbouwkundi|Agents for biological control of bacterial plant pathogens|

---

AU2012287003B2|2011-07-25|2015-09-10|Monsanto Technology, Llc|Compositions and methods for controlling head blight disease|

---

KR101279044B1|2011-08-29|2013-07-02|전남대학교산학협력단|Pantoea dispersa WCU35 strain, composition for control plant disease and control method of plant disease with same|

---

AU2012304197B2|2011-09-01|2016-02-11|Thinkbio Pty Ltd|Microbial composition, method and kit for enhancing plant growth|

---

CN102352327A|2011-09-06|2012-02-15|大连理工大学|Marine actinomycete L131 and metabolin, preparation method and application of metabolin|

---

RU2016124247A3|2011-09-23|2018-11-30|

---

CN107418911A|2011-12-13|2017-12-01|孟山都技术公司|Plant growth promotes microorganism and application thereof|

---

CN102533601B|2012-01-05|2013-10-16|陕西延长石油有限责任公司研究院|Bacillus simplex, and culture method and application thereof|

---

JP6268104B2|2012-02-17|2018-01-24|キージーン ナムローゼ フェンノートシャップ|Improvement of drought tolerance in plants: Pectinesterase|

---

AU2013203272C1|2012-06-01|2019-01-17|Agriculture Victoria Services Pty Ltd|Novel organisms|

---

EP2676536A1|2012-06-22|2013-12-25|AIT Austrian Institute of Technology GmbH|Method for producing plant seed containing endophytic micro-organisms|

---

EP3502235A1|2012-09-19|2019-06-26|Bioconsortia, Inc.|Methods of screening for microorganisms that impart beneficial properties to plants|

---

US9777267B2|2012-09-19|2017-10-03|Biodiscovery New Zealand Limited|Methods of screening for microorganisms that impart beneficial properties to plants|

---

US9732335B2|2012-09-19|2017-08-15|Biodiscovery New Zealand Limited|Methods of screening for microorganisms that impart beneficial properties to plants|

---

US8906668B2|2012-11-23|2014-12-09|Seres Health, Inc.|Synergistic bacterial compositions and methods of production and use thereof|

---

US9943082B2|2012-11-30|2018-04-17|Bayer Cropscience Ag|Ternary fungicidal mixtures|

---

MX368358B|2013-02-05|2019-09-30|Univ Saskatchewan|Endophytic microbial symbionts in plant prenatal care.|

---

EP3659414A1|2013-09-04|2020-06-03|Indigo Ag, Inc.|Agricultural endophyte-plant compositions, and methods of use|

---

EP3013134B1|2013-06-26|2020-11-25|Indigo AG, Inc.|Seed-origin endophyte populations, compositions, and methods of use|

---

US10136646B2|2013-06-26|2018-11-27|Indigo Ag, Inc.|Agricultural endophyte-plant compositions, and methods of use|

---

HUE050563T2|2014-06-26|2020-12-28|Indigo Ag Inc|Endophytes, associated compositions, and methods of use thereof|

---

EP3161124B1|2014-06-26|2020-06-03|Indigo Ag, Inc.|Endophytes, associated compositions, and methods of use thereof|

---

WO2015100432A2|2013-12-24|2015-07-02|Symbiota, Inc.|Method for propagating microorganisms within plant bioreactors and stably storing microorganisms within agricultural seeds|

---

US9770022B2|2013-06-26|2017-09-26|Bayer Cropscience Ag|N-cycloalkyl-N-[methylene]-carboxamide derivatives|

---

WO2015013558A1|2013-07-26|2015-01-29|Adaptive Symbiotic Technologies LLC|Compositions and method related to isolated endophytes|

---

HUE048814T2|2013-11-06|2020-08-28|Texas A & M Univ Sys|Fungal endophytes for improved crop yields and protection from pests|

---

CN103642725B|2013-11-28|2016-05-04|上海交通大学|Biocontrol bacterial strain of antagonism phytopathogen and uses thereof|

---

WO2015100431A2|2013-12-24|2015-07-02|Symbiota, Inc.|Plants containing beneficial endophytes|

---

US10387977B2|2014-02-25|2019-08-20|Pioneer Hi-Bred International, Inc.|Environmental management zone modeling and analysis|

---

US10000733B2|2014-06-19|2018-06-19|Arizona Board Of Regents On Behalf Of The University Of Arizona|Method for affecting phenotypic activity of endophytic fungi|

---

MX367032B|2014-06-20|2019-08-02|The Flinders Univ Of South Australia|Inoculants and methods for use thereof.|

---

EP3160220A4|2014-06-24|2017-12-20|360 Yield Center, LLC|Agronomic system, methods and apparatuses|

---

EP3240391A4|2014-12-30|2018-07-11|Indigo Agriculture, Inc.|Seed endophytes across cultivars and species, associated compositions, and methods of use thereof|

---

US9364005B2|2014-06-26|2016-06-14|Ait Austrian Institute Of Technology Gmbh|Plant-endophyte combinations and uses therefor|

---

CN104250616A|2014-09-03|2014-12-31|中国热带农业科学院热带生物技术研究所|Separation method for plant endophyte|

---

US10564316B2|2014-09-12|2020-02-18|The Climate Corporation|Forecasting national crop yield during the growing season|

---

WO2016057991A1|2014-10-10|2016-04-14|Cornell University|Directed selection of plant microbiomes|

---

US9652840B1|2014-10-30|2017-05-16|AgriSight, Inc.|System and method for remote nitrogen monitoring and prescription|

---

CN104388356B|2014-11-27|2018-02-06|沈阳化工研究院有限公司|Sang Puxun streptomycete bacterial strains, its separation method and application|

---

WO2016090212A1|2014-12-05|2016-06-09|Board Of Trustees Of Michigan State University|Methods and systems for precision crop management|

---

CN104560742B|2015-01-14|2018-03-23|浙江省林业科学研究院|Agriculture bacillus mediated ustilago esculenta transformant bacterial strain and its preparation method and application|

---

US20160260021A1|2015-03-06|2016-09-08|William Marek|System and method for improved agricultural yield and efficiency using statistical analysis|

---

AR105315A1|2015-05-01|2017-09-27|Indigo Agriculture Inc|COMPLEX COMPOSITIONS OF DESIGN ENDOPHYTS AND METHODS FOR IMPROVED CHARACTERS IN PLANTS|

---

EP3288361A4|2015-05-01|2018-09-19|Indigo Agriculture, Inc.|Isolated complex endophyte compositions and methods for improved plant traits|

---

RU2017146713A|2015-06-08|2019-07-15|Индиго Аг, Инк.|ENDOPHITE COMPOSITIONS WITH STREPTOMYCES AND METHODS FOR IMPROVING AGRONOMIC CHARACTERISTICS IN PLANTS|

---

WO2016210238A1|2015-06-26|2016-12-29|Indigo Agriculture, Inc|Penicillium endophyte compositions and methods for improved agronomic traits in plants|

---

US10624351B2|2016-12-01|2020-04-21|Indigo Ag, Inc.|Modulated nutritional quality traits in seeds|

---

MX2019007637A|2016-12-23|2019-12-16|Texas A & M Univ Sys|Fungal endophytes for improved crop yields and protection from pests.|

---

BR112019018232A2|2017-03-01|2020-07-28|Indigo Ag, Inc.|endophytic compositions and methods for improving plant traits|

---

MX2019010349A|2017-03-01|2019-11-21|Indigo Ag Inc|Endophyte compositions and methods for improvement of plant traits.|EP2676536A1|2012-06-22|2013-12-25|AIT Austrian Institute of Technology GmbH|Method for producing plant seed containing endophytic micro-organisms|

---

WO2014071182A1|2012-11-01|2014-05-08|Massachusetts Institute Of Technology|Directed evolution of synthetic gene cluster|

---

MX368358B|2013-02-05|2019-09-30|Univ Saskatchewan|Endophytic microbial symbionts in plant prenatal care.|

---

EP3161124B1|2014-06-26|2020-06-03|Indigo Ag, Inc.|Endophytes, associated compositions, and methods of use thereof|

---

WO2015100432A2|2013-12-24|2015-07-02|Symbiota, Inc.|Method for propagating microorganisms within plant bioreactors and stably storing microorganisms within agricultural seeds|

---

EP3013134B1|2013-06-26|2020-11-25|Indigo AG, Inc.|Seed-origin endophyte populations, compositions, and methods of use|

---

US10136646B2|2013-06-26|2018-11-27|Indigo Ag, Inc.|Agricultural endophyte-plant compositions, and methods of use|

---

HUE048814T2|2013-11-06|2020-08-28|Texas A & M Univ Sys|Fungal endophytes for improved crop yields and protection from pests|

---

US9580758B2|2013-11-12|2017-02-28|Luc Montagnier|System and method for the detection and treatment of infection by a microbial agent associated with HIV infection|

---

WO2015100431A2|2013-12-24|2015-07-02|Symbiota, Inc.|Plants containing beneficial endophytes|

---

MX367032B|2014-06-20|2019-08-02|The Flinders Univ Of South Australia|Inoculants and methods for use thereof.|

---

EP3240391A4|2014-12-30|2018-07-11|Indigo Agriculture, Inc.|Seed endophytes across cultivars and species, associated compositions, and methods of use thereof|

---

US9364005B2|2014-06-26|2016-06-14|Ait Austrian Institute Of Technology Gmbh|Plant-endophyte combinations and uses therefor|

---

AU2015308351A1|2014-08-29|2017-03-23|The Provost, Fellows, Fdn Scholars, & The Other Members Of Board, Of The College Of The Holy & Undiv|A method for improving the mean dry shoot weight, mean dry grain weight, and suppressing seed-borne infection in a cereal crop|

---

CN105002099B|2015-03-20|2017-12-01|西南大学|The endogenetic fungus of resistance to heavy metal Paraconiothyrium cyclothyrioides MR2 1 and its application|

---

EP3288361A4|2015-05-01|2018-09-19|Indigo Agriculture, Inc.|Isolated complex endophyte compositions and methods for improved plant traits|

---

AR105315A1|2015-05-01|2017-09-27|Indigo Agriculture Inc|COMPLEX COMPOSITIONS OF DESIGN ENDOPHYTS AND METHODS FOR IMPROVED CHARACTERS IN PLANTS|

---

RU2017146713A|2015-06-08|2019-07-15|Индиго Аг, Инк.|ENDOPHITE COMPOSITIONS WITH STREPTOMYCES AND METHODS FOR IMPROVING AGRONOMIC CHARACTERISTICS IN PLANTS|

---

WO2016210238A1|2015-06-26|2016-12-29|Indigo Agriculture, Inc|Penicillium endophyte compositions and methods for improved agronomic traits in plants|

---

CN108602729A|2015-07-13|2018-09-28|皮沃特生物公司|Improve the method and composition of plant trait|

---

CN108473937A|2015-12-28|2018-08-31|诺维信生物农业公司|Stable inoculation compositions and its production method|

---

CN105524076A|2016-01-13|2016-04-27|中国药科大学|Diazeniumdiolate nitric oxide-donating type oridonin derivatives, preparation method and application|

---

CN106010983B|2016-06-13|2019-10-29|中国农业科学院棉花研究所|Cotton endogenetic fungus CEF-559 and its application in cotton verticillium wilt prevention and treatment|

---

US10624351B2|2016-12-01|2020-04-21|Indigo Ag, Inc.|Modulated nutritional quality traits in seeds|

---

MX2019010349A|2017-03-01|2019-11-21|Indigo Ag Inc|Endophyte compositions and methods for improvement of plant traits.|

---

BR112019018232A2|2017-03-01|2020-07-28|Indigo Ag, Inc.|endophytic compositions and methods for improving plant traits|

---

US11263707B2|2017-08-08|2022-03-01|Indigo Ag, Inc.|Machine learning in agricultural planting, growing, and harvesting contexts|

---

CN111801005A|2017-12-15|2020-10-20|都柏林大学|Endophytes from wild barley populations to increase crop yield|

---

CN108576205B|2018-03-22|2022-01-04|湖北省农业科学院农产品加工与核农技术研究所|Processing method for strawberry combined drying|

---

CN111269298B|2018-11-19|2021-08-31|中国科学院植物研究所|Application of protein GhCCOAOMT7 in regulation and control of plant heat resistance|

---

CN110172411B|2019-05-29|2021-02-26|绍兴市曙光科技开发有限公司|Xylaria cruzi strain ZJ1811 and culture method and application thereof|

---

WO2021055656A1|2019-09-20|2021-03-25|The United States Of America, As Represented By The Secretary Of Agriculture|Compositions and methods for modifying a plant characteristic without modifying the plant genome|

---

CN111518723B|2020-04-27|2021-11-19|华南农业大学|Bacillus gorilla YC9L and application thereof|

法律状态:
2021-08-03| B06F| Objections, documents and/or translations needed after an examination request according [chapter 6.6 patent gazette]|

---

2021-08-17| B06U| Preliminary requirement: requests with searches performed by other patent offices: procedure suspended [chapter 6.21 patent gazette]|

---

2022-03-03| B06A| Patent application procedure suspended [chapter 6.1 patent gazette]|

优先权:

---

申请号 | 申请日 | 专利标题

---

PCT/CA2013/000091|WO2014121366A1|2013-02-05|2013-02-05|Endophytic microbial symbionts in plant prenatal care|

---